RegulonDB RegulonDB 10.8: Gene Sequence
moeB gene sequence


Size: 750        A: 167  T: 169  G: 227  C: 187

Fasta

 

>moeB E. coli K12. Version NC_000913.3 GI:556503834
atggcggaactcagcgatcaggagatgctgcgctacaaccggcaaatcattctgcgcggc
tttgattttgacggccaggaggcgctgaaagattctcgcgtgctgatagtgggcctgggc
ggcctcggctgtgcagcctcgcagtatctggcaagcgccggtgtcggtaacctgacgctg
ctcgacttcgacacggtttcgctctcgaatctgcaacgccagacactgcacagtgatgcc
acggtcgggcaaccgaaggtggaatccgcccgtgacgccctgacgcggatcaacccacat
atcgcgattacgccagtcaatgcactgctggatgacgcagaacttgcagcattgattgct
gaacacgatctggtgctcgactgtacggataacgttgcggtacgtaatcaactgaacgca
ggctgttttgccgcgaaggtaccgctggtttccggcgcggcaattcgtatggaaggtcaa
atcaccgtctttacttatcaggacggtgaaccgtgctatcgctgccttagccgtttgttt
ggtgaaaatgcattaacctgcgtggaagcaggcgtaatggcaccgttgatcggcgtaatt
ggttcgttgcaggcaatggaagcgatcaaaatgctggcaggttatggcaaaccggccagc
gggaaaatcgtcatgtacgatgcgatgacctgtcagtttcgcgaaatgaaactgatgcgt
aatccggggtgtgaggtgtgtgggcagtaa
              
                            

Download fasta file
RegulonDB