RegulonDB RegulonDB 10.9: Gene Sequence
cirA gene sequence


Size: 1992        A: 514  T: 427  G: 548  C: 503

Fasta

 

>cirA E. coli K12. Version NC_000913.3 GI:556503834
atgtttaggttgaaccctttcgtacgggtcgggctgtgtttgtccgctatttcttgtgca
tggcctgtgttagcggtcgatgatgatggcgaaacgatggttgtcactgcatcttccgtg
gaacaaaatcttaaagatgcacctgccagtatcagcgtcattacccaggaagacctgcag
cgaaaaccggtacagaatctgaaggatgtcctcaaagaagtgcctggcgtacaactgacg
aacgaaggggataaccgtaagggcgttagtattcgtggtctggacagcagctataccctg
attctcgtcgacggtaaacgcgtgaactcccgcaatgccgtcttccgccacaatgatttc
gatctgaactggatcccggtcgattccatcgaacgtattgaagtggtccgtggcccgatg
tcgtcgctgtacggttccgatgcgctcggcggtgtagtgaatatcatcaccaaaaaaatc
ggtcagaaatggtcgggtaccgttaccgtcgataccaccattcaggaacatcgcgatcgc
ggtgacacctataacggtcagttctttaccagtggaccattaattgatggtgtgctggga
atgaaagcttacggcagcctggcaaaacgtgaaaaggatgacccgcaaaactcaacgacc
accgataccggagaaacgccgcgtattgaaggattctccagccgcgacggcaatgtcgaa
tttgcctggacaccgaatcaaaatcacgattttactgccggatacggtttcgaccgtcag
gatcgtgattccgactcgctggacaaaaaccgcctggaacgccagaactactccgtcagc
cataatgggcgttgggattacggcaccagcgaactgaaatactacggtgagaaagtcgag
aacaaaaaccctggcaacagcagcccgataacttccgaaagcaatacggtcgacggcaaa
tacacgttgccgctgacggcgattaatcagtttctcacggttggcggtgaatggcgtcac
gacaaacttagcgatgcggtgaacctgaccgggggaaccagctccaaaacgtctgccagc
cagtacgcgctgtttgtggaagatgaatggcggatcttcgagccgctggcgctgacgacc
ggcgtgcgtatggacgatcacgaaacctacggtgaacactggagtccgcgtgcctacctg
gtttataacgccaccgacaccgtaacggtgaaagggggctgggcgacggcatttaaagca
ccttctctgttgcaacttagccctgactggacgagcaattcctgccgtggcgcatgtaag
attgtgggtagcccggatctgaaaccagaaaccagcgaaagttgggagctggggctttac
tacatgggtgaagaaggctggctggaaggggttgaatccagcgttaccgttttccgtaac
gatgtgaaagatcgtatcagcatcagccgtacgtctgacgtcaacgctgcaccgggctac
caaaactttgttggttttgagacgggcgctaacggacggcgcataccggtatttagctac
tacaacgttaacaaagctcgtattcagggcgtggaaaccgaactgaaaattccgttcaac
gatgaatggaaactgtcgatcaactacacctacaacgatggtcgtgatgtcagcaacggc
gaaaacaaaccgctatccgatctgccgttccatactgctaacggtacgctggactggaaa
ccgctggcgctggaagactggtcattctatgtttctgggcactataccgggcagaaacgc
gccgacagcgcgacggctaaaacaccgggcggttataccatctggaataccggcgcggcc
tggcaggtgactaaagacgtcaaactgcgcgcaggcgtgctgaaccttggcgacaaggat
ctcagtcgtgacgactacagctataacgaagacggacgtcgttactttatggcagtggat
tatcgcttctga
              
                            

Download fasta file
RegulonDB