RegulonDB RegulonDB 10.10: Gene Sequence
clpA gene sequence


Size: 2277        A: 560  T: 519  G: 653  C: 545

Fasta

 

>clpA E. coli K12. Version NC_000913.3 GI:556503834
atgctcaatcaagaactggaactcagtttaaatatggctttcgccagagcgcgcgagcac
cgtcatgagtttatgaccgtcgagcacttgttactggcgctgctcagtaacccatctgcc
cgggaggcgctggaagcgtgttctgtggatttggttgcgctccgtcaggaactggaagcc
tttattgaacaaaccacacccgttctgcctgccagtgaagaggagcgcgacacacagccg
acgctgagttttcagcgtgtactgcaacgtgcggtcttccatgtccagtcctccggtcgc
aatgaggttaccggtgcaaacgttctggtcgctatctttagcgaacaggagtcgcaggcg
gcatatctgttgcgtaaacatgaagtcagccgtctcgatgtggtgaactttatctctcat
ggcacgcgtaaagacgagccgacacagtcttctgatcctggcagccagccaaacagcgaa
gaacaagctggtggggaggaacgtatggagaatttcacgacgaacctgaatcagcttgcg
cgcgtgggcggaatcgacccactgattggtcgtgagaaggagctggagcgtgctattcag
gttctctgccgtcgccgtaaaaacaacccgctgctggtgggggaatctggtgtcggtaaa
accgcgattgcggaaggtcttgcctggcgaattgttcagggcgatgtgccggaagtgatg
gctgactgtacgatttactctctcgatatcggttctctgttagcgggcacaaaatatcgc
ggcgactttgaaaaacgttttaaagcgttgctcaagcagctggagcaggacactaacagc
atcctgtttattgatgagatccacaccattatcggtgcgggtgcagcgtctggtggtcag
gtcgatgcggctaacctaatcaaaccgttgctctccagcggtaaaattcgtgtaattggt
tcgacaacctatcaggagttcagcaacattttcgagaaagaccgtgctctggcgcgtcgc
ttccagaaaattgatattactgaaccgtcgatcgaagaaactgttcaaatcatcaatggc
ctgaaaccgaagtatgaagcgcaccacgacgtgcgttataccgcaaaagcggtgcgtgcg
gcggtagagctggcggtgaaatacattaacgatcgtcatctgccggataaagccattgat
gttatcgacgaagcgggcgctcgcgcacgcctgatgccggtaagcaaacgcaagaaaacc
gttaatgtggcggatattgagtccgtggtggcccgtattgcacgcattccagagaagagt
gtttctcagagtgatcgtgataccctgaaaaacctcggcgatcgcttgaaaatgctggtc
ttcggtcaggataaagccattgaggcgctgactgaagccattaagatggcgcgtgcaggt
ttaggtcacgaacataaaccggttggttcgttcctgtttgccggccctaccggggtcggg
aaaacagaggtgacggtacagctttcgaaagctttgggcattgagcttctgcgctttgat
atgtccgagtatatggaacgccataccgtcagccgtcttattggtgcgcctccgggatac
gttggttttgatcagggcggtttgctgactgatgcggtcatcaagcatccacatgcggtg
ctgctgctggacgaaatcgagaaagcgcacccggacgtgttcaatattctgttgcaggtg
atggataacggtacgctgaccgataacaacggacgcaaagcagacttccgtaacgtggtg
ctggtgatgaccaccaacgccggggtacgggaaactgagcgcaaatccattggtcttatc
caccaggataacagcaccgatgcgatggaagagatcaagaagatctttacaccggaattc
cgtaaccgtctcgacaacattatctggtttgatcatctgtcaaccgacgtgatccatcag
gtggtggataaattcatcgtcgagttgcaggttcagctggatcagaaaggtgtttctctg
gaagtgagccaggaagcgcgtaactggctggccgagaaaggttacgaccgggcaatgggc
gctcgtccgatggcgcgtgtcatccaggacaacctgaaaaaaccgctcgccaacgaactg
ctgtttggttcgctggtggacggcggtcaggtcaccgtcgcgctggataaagagaaaaat
gagctgacttacggattccagagtgcacaaaagcacaaggcggaagcagcgcattaa
              
                            

Download fasta file
RegulonDB