RegulonDB RegulonDB 10.8: Gene Sequence
cpsB gene sequence


Size: 1437        A: 329  T: 315  G: 440  C: 353

Fasta

 

>cpsB E. coli K12. Version NC_000913.3 GI:556503834
atggcgcagtcgaaactctatccagttgtgatggcaggtggctccggtagccgcttatgg
ccgctttcccgcgtactttatcccaagcagtttttatgcctgaaaggcgatctcaccatg
ctgcaaaccaccatctgccgcctgaacggcgtggagtgcgaaagcccggtggtgatttgc
aatgagcagcaccgctttattgtcgcggaacagctgcgtcaactgaacaaacttaccgag
aacattattctcgaaccggcagggcgaaacacggcacctgccattgcgctggcggcgctg
gcggcaaaacgtcatagcccggagagcgacccgttaatgctggtattggcggcggatcat
gtgattgccgatgaagacgcgttccgtgccgccgtgcgtaatgccatgccatatgccgaa
gcgggcaagctggtgaccttcggcattgtgccggatctaccagaaaccggttatggctat
attcgtcgcggtgaagtgtctgcgggtgagcaggatatggtggcctttgaagtggcgcag
tttgtcgaaaaaccgaatctggaaaccgctcaggcctatgtggcaagcggcgaatattac
tggaacagcggtatgttcctgttccgcgccggacgctatctcgaagaactgaaaaaatat
cgcccggatatcctcgatgcctgtgaaaaagcgatgagcgccgtcgatccggatctcaat
tttattcgcgtggatgaagaagcgtttctcgcctgcccggaagagtcggtggattacgcg
gtcatggaacgtacggcagatgctgttgtggtgccgatggatgcgggctggagcgatgtt
ggctcctggtcttcattatgggagatcagcgcccacaccgccgagggcaacgtttgccac
ggcgatgtgattaatcacaaaactgaaaacagctatgtgtatgctgaatctggcctggtc
accaccgtcggggtgaaagatctggtagtggtgcagaccaaagatgcggtgctgattgcc
gaccgtaacgcggtacaggatgtgaaaaaagtggtcgagcagatcaaagccgatggtcgc
catgagcatcgggtgcatcgcgaagtgtatcgtccgtggggcaaatatgactctatcgac
gcgggcgaccgctaccaggtgaaacgcatcaccgtgaaaccgggcgagggcttgtcggta
cagatgcaccatcaccgcgcggaacactgggtggttgtcgcgggaacggcaaaagtcacc
attgatggtgatatcaaactgcttggtgaaaacgagtccatttatattccgctgggggcg
acgcattgcctggaaaacccggggaaaattccgctcgatttaattgaagtgcgctccggc
tcttatctcgaagaggatgatgtggtgcgtttcgcggatcgctacggacgggtgtaa
              
                            

Download fasta file
RegulonDB