RegulonDB RegulonDB 10.9: Gene Sequence
cpsG gene sequence


Size: 1371        A: 326  T: 290  G: 388  C: 367

Fasta

 

>cpsG E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaattaacctgctttaaagcctatgatattcgcgggaaattaggcgaagaactg
aatgaagatatcgcctggcgcattggtcgcgcctatggcgaatttctcaaaccgaaaacc
attgtgttaggcggtgatgtccgcctcaccagcgaaaccttaaaactggcgctggcgaaa
ggtttacaggatgcgggcgttgacgtgctggatattggtatgtccggcaccgaagagatc
tatttcgccacgttccatctcggcgtggatggcggcattgaagttaccgccagccataat
ccgatggattataacggcatgaagctggttcgcgagggggctcgcccgatcagcggagat
accggactgcgcgacgtccagcgtctggctgaagccaacgactttcctcccgtcgatgaa
accaaacgcggtcgctatcagcaaatcaacctgcgtgacgcttacgttgatcacctgttc
ggttatatcaatgtcaaaaacctcacgccgctcaagctggtgatcaactccgggaacggc
gcagcgggtccggtggtggacgccattgaagcccgctttaaagccctcggcgcgcccgtg
gaattaatcaaagtgcacaacacgccggacggcaatttccccaacggtattcctaaccca
ctactgccggaatgccgcgacgacacccgcaatgcggtcatcaaacacggcgcggatatg
ggcattgcttttgatggcgattttgaccgctgtttcctgtttgacgaaaaagggcagttt
attgagggctactacattgtcggcctgttggcagaagcattcctcgaaaaaaatcccggc
gcgaagatcatccacgatccacgtctctcctggaacaccgttgatgtggtgactgccgca
ggtggcacgccggtaatgtcgaaaaccggacacgcctttattaaagaacgtatgcgcaag
gaagacgccatctatggtggcgaaatgagcgcccaccattacttccgtgatttcgcttac
tgcgacagcggcatgatcccgtggctgctggtcgccgaactggtgtgcctgaaagataaa
acgctgggcgaactggtacgcgaccggatggcggcgtttccggcaagcggtgagatcaac
agcaaactggcgcaacccgttgaggcgattaaccgcgtggaacagcattttagccgtgag
gcgctggcggtggatcgcaccgatggcatcagcatgacctttgccgactggcgctttaac
ctgcgcacctccaataccgaaccggtggtgcgcctgaatgtggaatcgcgcggtgatgtg
ccgctgatggaagcgcgaacgcgaactctgctgacgttgctgaacgagtaa
              
                            

Download fasta file
RegulonDB