RegulonDB RegulonDB 10.9: Gene Sequence
cpxA gene sequence


Size: 1374        A: 309  T: 315  G: 409  C: 341

Fasta

 

>cpxA E. coli K12. Version NC_000913.3 GI:556503834
atgataggcagcttaaccgcgcgcatcttcgccatcttctggctgacgctggcgctggtg
ttgatgttggttttgatgttacccaagctcgattcacgccagatgaccgagcttctggat
agcgaacagcgtcaggggctgatgattgagcagcatgtcgaagcggagctggcgaacgat
ccgcccaacgatttaatgtggtggcggcgtctgttccgggcgattgataagtgggcaccg
ccaggacagcgtttgttattggtgaccaccgaaggccgcgtgatcggcgctgaacgcagc
gaaatgcagatcattcgtaactttattggtcaggccgataacgccgatcatccgcagaag
aaaaagtatggccgcgtggaactggtcggtccgttctccgtgcgtgatggcgaagataat
taccaactttatctgattcgtccggccagcagttctcaatccgatttcattaacttactg
tttgaccgcccgctattactgctgattgtcaccatgttggtcagtacgccgctgctgttg
tggttggcctggagtctggcaaaaccggcgcgtaagctgaaaaacgctgccgatgaagtt
gcccagggaaacttacgccagcacccggaactggaagcggggccacaggaattccttgcc
gcaggtgccagttttaaccagatggtcaccgcgctggagcgcatgatgacctctcagcag
cgtctgctttctgatatctctcacgagctgcgcaccccgctgacgcgtctgcaactgggt
acggcgttactgcgccgtcgtagcggtgaaagcaaggaactggagcgtattgaaaccgaa
gcgcaacgtctggacagcatgatcaacgatctgttggtgatgtcacgtaatcagcaaaaa
aacgcgctggttagcgaaaccatcaaagccaaccagttgtggagtgaagtgctggataac
gcggcgttcgaagccgagcaaatgggcaagtcgttgacagttaacttcccgcctgggccg
tggccgctgtacggcaatccgaacgccctggaaagtgcgctggaaaacattgttcgtaat
gctctgcgttattcccatacgaagattgaagtgggctttgcggtagataaagacggtatc
accattacggtggacgacgatggtcctggcgttagcccggaagatcgcgaacagattttc
cgtccgttctatcgtaccgatgaagcacgcgatcgtgaatctggcggtacaggtttgggg
ctggcgattgttgaaaccgccattcagcagcatcgtggctgggtgaaggcagaagacagc
ccgctgggcggtttacggctggtgatttggttgccgctgtataagcggagttaa
              
                            

Download fasta file
RegulonDB