RegulonDB RegulonDB 10.9: Gene Sequence
crp gene sequence


Size: 633        A: 174  T: 146  G: 161  C: 152

Fasta

 

>crp E. coli K12. Version NC_000913.3 GI:556503834
atggtgcttggcaaaccgcaaacagacccgactctcgaatggttcttgtctcattgccac
attcataagtacccatccaagagcacgcttattcaccagggtgaaaaagcggaaacgctg
tactacatcgttaaaggctctgtggcagtgctgatcaaagacgaagagggtaaagaaatg
atcctctcctatctgaatcagggtgattttattggcgaactgggcctgtttgaagagggc
caggaacgtagcgcatgggtacgtgcgaaaaccgcctgtgaagtggctgaaatttcgtac
aaaaaatttcgccaattgattcaggtaaacccggacattctgatgcgtttgtctgcacag
atggcgcgtcgtctgcaagtcacttcagagaaagtgggcaacctggcgttcctcgacgtg
acgggccgcattgcacagactctgctgaatctggcaaaacaaccagacgctatgactcac
ccggacggtatgcaaatcaaaattacccgtcaggaaattggtcagattgtcggctgttct
cgtgaaaccgtgggacgcattctgaagatgctggaagatcagaacctgatctccgcacac
ggtaaaaccatcgtcgtttacggcactcgttaa
              
                            

Download fasta file
RegulonDB