RegulonDB RegulonDB 10.9: Gene Sequence
lnt gene sequence


Size: 1539        A: 293  T: 389  G: 436  C: 421

Fasta

 

>lnt E. coli K12. Version NC_000913.3 GI:556503834
atggcttttgcctcattaattgaacgccagcgcattcgcctgctgctggcgttattattc
ggtgcctgcggaacgctggccttctctccttacgacgtctggcctgcggcgattatttcg
ctgatggggcttcaggcgttgacctttaaccgccgtccactccagtctgccgctattggc
ttttgctggggatttggcctctttggcagcggtattaactgggtctatgtcagcatcgcg
acctttggcggaatgcctggcccggttaacatcttcctggtggtgctgctggcggcgtat
ttgtcgctgtataccggactgtttgctggcgtgctgtcgcgtctgtggccgaaaaccacc
tggctgcgcgtagcgattgccgcccctgccctctggcaagtgaccgagtttctgcgcggt
tgggtactgaccggcttcccgtggttacagttcggctatagccagattgatggcccgtta
aaagggctggcaccgataatgggcgtggaagccattaacttcctgctgatgatggttagt
ggcctgctggcactggcgttggtcaaacgcaactggcgtccgctggtggtggccgtcgtg
ctgtttgcccttcccttcccgctgcgttacatccagtggtttaccccacaaccggagaaa
accattcaggtttcgatggttcagggcgatattccgcaatcgctgaaatgggacgaaggc
cagcttcttaatacgctgaagatttactacaacgcaacggcaccgctgatgggcaaatca
tcgttgattatctggccggagtcggcgataaccgatctggaaattaatcagcaaccgttc
ctcaaagcactggacggtgagttgcgtgataaaggtagctcgctggtaaccgggattgtc
gacgcgcgtctcaataagcagaaccgctacgatacctacaacaccatcatcacgctgggt
aaaggtgcgccgtacagctacgaatcagccgatcgctataacaaaaaccatctggtgccg
tttggcgagtttgtcccgctggagtcgattctgcgtccgttagcaccgttctttgatctg
ccgatgtcgtcgttcagccgtgggccatatatccagccgccgctgtcggcaaatggtatt
gagcttactgcggctatttgctacgagatcattctcggcgagcaagtgcgcgataacttc
cgcccggataccgactatctgctgactatctccaacgatgcgtggtttggtaaatctatt
ggtccatggcaacacttccagatggcgcgaatgcgtgcgctggagctggcgcgcccactg
ttgcgcagcaccaacaacggcattacggcggtgattggcccgcagggtgagattcaggcg
atgatcccgcagttcacccgcgaggtgttaaccactaacgtgacgccgaccaccggactc
acaccatacgcacgtaccggcaactggccgctgtgggtgctgacggcattgtttggtttt
gctgctgtgttgatgagtctgcgtcagcgacgtaaataa
              
                            

Download fasta file
RegulonDB