RegulonDB RegulonDB 10.9: Gene Sequence
cvpA gene sequence


Size: 489        A: 87  T: 162  G: 134  C: 106

Fasta

 

>cvpA E. coli K12. Version NC_000913.3 GI:556503834
atggtctggattgattacgccataatcgcggtgattgctttttcctctctggttagcctg
atccgcggctttgttcgtgaagcgttatcgctggtgacatggggttgtgctttctttgtt
gccagtcattactacacttacctgtcagtctggtttacgggctttgaagacgaactggtt
cgaaatgggattgccatcgcggtactgtttatcgctaccctgatcgttggtgctatcgtg
aacttcgtgataggccagttggtggagaaaacggggttgtcaggcaccgatcgggtgctg
ggcgtctgtttcggtgcgttgcgcggtgtgttgattgttgctgccattctcttctttctc
gactcctttaccggggtgtcgaaaagcgaagactggagcaaatcacagctgatcccgcaa
ttcagttttatcatcagatgtttttttgattatctgcaaagctcgtcaagtttcttgccc
agagcgtaa
              
                            

Download fasta file
RegulonDB