RegulonDB RegulonDB 10.9: Gene Sequence
cybB gene sequence


Size: 531        A: 119  T: 159  G: 133  C: 120

Fasta

 

>cybB E. coli K12. Version NC_000913.3 GI:556503834
atggaaaataaatattcaaggttacaaatcagcattcactggctggtctttttactggtt
atcgcagcgtattgcgcaatggagtttcgtggtttcttcccacgtagcgatcggccactc
atcaacatgattcatgtttcctgtggcatctcaattctcgtgctgatggtcgttcgtctt
ttgttaaggctgaaatacccaaccccgccgattatacctaagccaaaaccgatgatgacg
ggactggcgcatttgggacatttggtgatttatctcctgtttattgcgctgccagtgatt
ggtttggtgatgatgtataaccggggcaacccgtggtttgcgtttggtttgacgatgcct
tacgcttcagaggccaatttcgaacgggtagatagcttaaagtcgtggcatgaaacgctg
gcgaatctgggatattttgtcatcgggttgcacgctgcggctgcactggcacaccactat
ttctggaaggacaacacacttctacgcatgatgccgcgtaaacgttcctga
              
                            

Download fasta file
RegulonDB