RegulonDB RegulonDB 10.9: Gene Sequence
cydA gene sequence


Size: 1569        A: 314  T: 425  G: 426  C: 404

Fasta

 

>cydA E. coli K12. Version NC_000913.3 GI:556503834
atgttagatatagtcgaactgtcgcgcttacagtttgccttgaccgcgatgtaccacttc
ctttttgtgccactgacgctcggtatggcgttcctgctggccattatggaaacggtctac
gtcctctccggcaaacagatttataaagatatgaccaagttctggggcaagttgtttggt
atcaacttcgctctgggtgtggctaccggtctgaccatggagttccagttcgggactaac
tggtcttactattcccactatgtaggggatatcttcggtgcgccgctggcaatcgaaggt
ctgatggccttcttcctcgaatccacctttgtaggtctgttcttcttcggttgggatcgt
ctgggtaaagttcagcatatgtgtgtcacctggctggtggcgctcggttcaaacctgtcc
gcactgtggattctggttgcgaacggctggatgcaaaacccaatcgcgtccgatttcaac
tttgaaactatgcgtatggagatggtgagcttctccgagctggtgcttaacccggttgct
caggtgaaattcgttcacactgtagcgtctggttatgtgactggcgcgatgttcatcctc
ggtatcagcgcatggtatatgctgaaaggtcgtgacttcgccttcgctaaacgctccttt
gctatcgctgccagcttcggtatggctgctgttctgtctgttattgttctgggtgatgaa
tccggctacgaaatgggcgacgtgcagaaaaccaaactggctgctattgaagccgagtgg
gaaacgcaacctgcgcctgctgcctttactctgttcggcattcctgatcaggaagaggag
acgaacaaatttgcgattcagatcccttacgcactgggcatcattgcaacgcgttccgtg
gataccccggttatcggcctgaaagagctgatggtgcagcatgaagaacgcattcgtaac
gggatgaaggcgtactctctgctcgaacaactgcgttctggttctaccgaccaggcggtt
cgtgaccagttcaatagcatgaagaaagacctcggttacggtctgctgctgaaacgctat
acgccaaacgtggctgatgcgactgaagcgcagattcaacaggcaaccaaagactccatc
ccgcgtgtagcgccgctgtactttgcgttccgtatcatggtggcgtgtggcttcctgctt
ctggcaatcatcgcgctctctttctggagtgtcatccgcaaccgcattggcgagaaaaaa
tggcttctgcgcgccgcgctgtacggtattccgctgccgtggattgctgtagaagcgggc
tggttcgtggctgaatatggccgccaaccgtgggctatcggtgaagtgctgccgacagct
gtggcgaactcgtcactgaccgcaggcgatctcatcttctcaatggtgctgatttgcggc
ctgtataccctgttcctggtggcagaattgttcttaatgttcaagtttgcacgcctcggc
ccaagcagcctgaaaaccggtcgctatcactttgagcagtcttccacgactactcagccg
gcacgctaa
              
                            

Download fasta file
RegulonDB