RegulonDB RegulonDB 10.9: Gene Sequence
cydB gene sequence


Size: 1140        A: 213  T: 313  G: 320  C: 294

Fasta

 

>cydB E. coli K12. Version NC_000913.3 GI:556503834
atgatcgattatgaagtattgcgttttatctggtggctgctggttggcgttctgctgatt
ggttttgcagtcactgacggtttcgacatgggggtgggcatgctcacccgtttcctcggt
cgtaacgacaccgagcgtcgaattatgattaactccattgcaccacactgggacggtaac
caggtttggctgatcaccgcgggcggcgcactctttgctgcctggccgatggtctatgcc
gctgcgttctccggcttctatgtggcgatgatcctcgtgctggcgtctttgttcttccgt
ccggtcggttttgactaccgctccaagattgaagaaacccgctggcgtaacatgtgggac
tggggcatcttcattggtagcttcgttccgccgctggtaattggtgtagcgttcggtaac
ctgttgcagggcgtaccgttcaacgttgatgaatatctgcgtctgtactacaccggtaac
ttcttccagttgcttaacccgttcggcctgctggcaggcgtggtgagcgtagggatgatc
attactcagggcgcaacctatctgcaaatgcgtaccgtgggcgaactgcacctgcgtacc
cgtgcaacggctcaggtggctgcgctggtgacactggtctgtttcgcactggctggcgta
tgggtgatgtacggtatcgatggttatgtcgtgaaatcgacaatggaccattacgcagcc
tctaacccactgaataaagaagtggttcgtgaagctggcgcatggctggttaacttcaac
aacacgccaattctgtgggctattccggcactgggtgtggttctgccgctgctgaccatc
ctgactgcacgtatggataaagccgcgtgggcgtttgtgttctcctccctgacgctggcc
tgcatcatcctgacagccggtatcgcaatgttcccgtttgtgatgccgtccagcaccatg
atgaacgcaagtctgacaatgtgggatgcaacttccagccagctgacgcttaacgtcatg
acctgggttgcggtggttctggtaccgatcattctgctctacaccgcctggtgttactgg
aaaatgttcggtcgtatcaccaaagaagatattgaacgtaacacccactctctgtactaa
              
                            

Download fasta file
RegulonDB