RegulonDB RegulonDB 10.8: Gene Sequence
cynT gene sequence


Size: 660        A: 125  T: 157  G: 184  C: 194

Fasta

 

>cynT E. coli K12. Version NC_000913.3 GI:556503834
gtgaaagagattattgatggattccttaaattccagcgcgaggcatttccgaagcgggaa
gccttgtttaaacagctggcgacacagcaaagcccgcgcacactttttatctcctgctcc
gacagccgtctggtccctgagctggtgacgcaacgtgagcctggcgatctgttcgttatt
cgcaacgcgggcaatatcgtcccttcctacgggccggaacccggtggcgtttctgcttcg
gtggagtatgccgtcgctgcgcttcgggtatctgacattgtgatttgtggtcattccaac
tgtggcgcgatgaccgccattgccagctgtcagtgcatggaccatatgcctgccgtctcc
cactggctgcgttatgccgattcagcccgcgtcgttaatgaggcgcgcccgcattccgat
ttaccgtcaaaagctgcggcgatggtacgtgaaaacgtcattgctcagttggctaatttg
caaactcatccatcggtgcgcctggcgctcgaagaggggcggatcgccctgcacggctgg
gtctacgacattgaaagcggcagcatcgcagcttttgacggcgcaacccgccagtttgtg
ccactggccgctaatcctcgcgtttgtgccataccgctacgccaaccgaccgcagcgtaa
              
                            

Download fasta file
RegulonDB