RegulonDB RegulonDB 10.8: Gene Sequence
cynX gene sequence


Size: 1155        A: 173  T: 304  G: 374  C: 304

Fasta

 

>cynX E. coli K12. Version NC_000913.3 GI:556503834
atgctgctggtactggtgctgattggtcttaatatgcgaccactgctcacctccgtcggg
ccactgctaccgcaattgcgccaggcgagcggaatgagctttagcgtggctgccctgttg
accgctctgccggtggttaccatgggcgggctggcgctggccggaagctggcttcatcag
catgtcagcgaacgtcgcagtgtcgccatcagtctgttgctgattgccgtcggtgcattg
atgcgtgagctttacccgcaaagtgcgctgctgcttagcagcgcactgcttggtggggtg
gggatcggcatcattcaggcggtgatgccttcggtgattaaacggcggtttcagcagcgc
acgccactggtgatggggctgtggtccgcggctctgatgggcggcggtgggcttggtgcc
gccataacgccctggttagttcaacatagcgaaacctggtatcaaacactcgcctggtgg
gcgctgcctgccgttgttgcgctctttgcctggtggtggcaaagcgcccgcgaggtcgcc
tcttcccacaagacaacaaccactccggttcgcgtggtattcactccccgcgcgtggacg
ctgggtgtttacttcggtctgattaacggcggttacgccagcctgattgcctggttaccc
gctttctatattgagattggtgccagcgcgcagtacagcggttccttactggcattgatg
acgcttgggcaagccgcaggagctttgctgatgcctgctatggctcgccatcaggatcgg
cgcaaactgttaatgctggcgctggtgttacaactggtggggttctgcggctttatctgg
ctgccgatgcaattgccggtattgtgggcgatggtgtgtgggttaggtctgggcggcgcg
tttccgctctgtttgctgctggcgctcgatcactctgtgcaaccggctattgctggcaag
ctggtggcgtttatgcagggaatcggttttatcatcgccgggcttgccccgtggttttct
ggcgtgctgcgtagtatcagcggcaattacctgatggactgggcatttcatgcgctgtgc
gtcgttgggctgatgatcataaccctgcgttttgcaccagtacgttttccgcagctgtgg
gtcaaagaggcatga
              
                            

Download fasta file
RegulonDB