RegulonDB RegulonDB 10.9: Gene Sequence
cyoB gene sequence


Size: 1992        A: 389  T: 548  G: 538  C: 517

Fasta

 

>cyoB E. coli K12. Version NC_000913.3 GI:556503834
atgttcggaaaattatcacttgatgcagtcccgttccatgaacctatcgtcatggttacg
atcgctggcattattttgggaggtctggcgctcgttggcctgatcacttacttcggtaag
tggacctacctgtggaaagagtggctgacctccgtcgaccataaacgcctcggtatcatg
tatatcatcgtggcgattgtgatgttgctgcgtggttttgctgacgccattatgatgcgt
agccagcaggctcttgcctcggcgggcgaagcgggcttcctgccacctcaccactacgat
cagatctttaccgcgcacggcgtgattatgatcttcttcgtggcgatgcctttcgttatc
ggtctgatgaacctggtggttccgctgcagatcggcgcgcgtgacgttgcgttcccgttc
ctcaacaacttaagcttctggtttaccgttgttggtgtgattctggttaacgtttctctc
ggcgtgggcgaatttgcgcagaccggctggctggcctatccaccgctatcgggaatagag
tacagtccgggagtcggtgtcgattactggatatggagtctccagctatccggtataggt
acgacgcttaccggtatcaacttcttcgttaccattctgaagatgcgcgcaccgggcatg
accatgttcaagatgccagtatttacctgggcatcactgtgcgcgaacgtactgattatt
gcttccttcccaattctgacggttaccgtcgcgttgttgaccctggatcgctatctgggc
acccatttctttaccaacgatatgggtggcaacatgatgatgtacatcaacctgatttgg
gcctggggccacccggaagtttacatcctgatcctgcctgttttcggtgtgttctccgaa
attgcggcaaccttctcgcgtaaacgtctgtttggttatacctcgctggtatgggcaacc
gtctgtatcaccgtgctgtcgttcatcgtttggctgcaccacttctttacgatgggtgcg
ggcgcgaacgtaaacgccttctttggtatcaccacaatgattatcgccatcccgaccggg
gtgaagatcttcaactggctgttcaccatgtatcagggccgcatcgtgttccattctgcg
atgctgtggaccatcggttttatcgtcaccttctcggtgggcgggatgactggcgtgctg
ctggccgtaccgggcgcggacttcgttctgcataacagcctgttcctgattgcgcacttc
cataacgtgatcatcggcggcgtggtcttcggctgcttcgcagggatgacctactggtgg
cctaaagcgttcggtttcaaactgaacgaaacctggggtaaacgcgcgttctggttctgg
atcatcggcttcttcgttgcctttatgccactgtatgcgctgggcttcatgggcatgacc
cgtcgtttgagccagcagattgacccgcagttccacaccatgctgatgattgcagccagc
ggtgcagtactgattgcgctgggtattctctgcctcgttattcagatgtacgtttctatt
cgcgaccgcgaccagaaccgtgacctgactggcgacccgtggggtggccgtacgctggag
tgggcaacctcttccccgcctccgttctataactttgccgtagtgccgcacgttcacgaa
cgtgatgcattctgggaaatgaaagagaaaggcgaagcgtataaaaagcctgaccactat
gaagaaattcatatgccgaaaaacagcggtgcaggtatcgtcattgcagctttctccacc
atcttcggtttcgccatgatctggcatatctggtggctggcgattgttggcttcgcaggc
atgatcatcacctggatcgtgaaaagcttcgacgaggacgtggattactacgtgccggtg
gcagaaatcgaaaaactggaaaaccagcatttcgatgagattactaaggcagggctgaaa
aatggcaactga
              
                            

Download fasta file
RegulonDB