RegulonDB RegulonDB 10.9: Gene Sequence
cyoC gene sequence


Size: 615        A: 116  T: 170  G: 167  C: 162

Fasta

 

>cyoC E. coli K12. Version NC_000913.3 GI:556503834
atggcaactgatactttgacgcacgcgactgcccacgcgcacgaacacgggcaccacgat
gcaggcggaaccaaaatcttcggattttggatctacctgatgagcgactgcattctgttc
tctatcttgtttgctacctatgccgttctggtgaacggcaccgcaggcggcccgacaggt
aaggacattttcgaactgccgttcgttctggttgaaactttcttgctgttgttcagctcc
atcacctacggcatggcggctatcgccatgtacaaaaacaacaaaagccaggttatctcc
tggctggcgttgacctggttgtttggtgccggatttatcgggatggaaatctatgaattc
catcacctgattgttaacggcatgggtccggatcgcagcggcttcctgtcagcgttcttt
gcgctggtcggcacgcacggtctgcacgtcacttctggtcttatctggatggcggtgctg
atggtgcaaatcgcccgtcgcggcctgaccagcactaaccgtacccgcatcatgtgcctg
agcctgttctggcacttcctggatgtggtttggatctgtgtgttcactgttgtttatctg
atgggggcgatgtaa
              
                            

Download fasta file
RegulonDB