RegulonDB RegulonDB 10.9: Gene Sequence
cyoD gene sequence


Size: 330        A: 78  T: 88  G: 83  C: 81

Fasta

 

>cyoD E. coli K12. Version NC_000913.3 GI:556503834
atgagtcattctaccgatcacagcggcgcgtcccatggcagcgtaaaaacctacatgaca
ggctttatcctgtcgatcattctgacggtgattccgttctggatggtgatgacaggagct
gcctctccggccgtaattctgggaacaatcctggcaatggcagtggtacaggttctggtg
catctggtgtgcttcctgcacatgaataccaaatcagatgaaggctggaacatgacggcg
tttgtcttcaccgtgctaatcatcgctatcctggttgtaggctccatctggattatgtgg
aacctcaactacaacatgatgatgcactaa
              
                            

Download fasta file
RegulonDB