RegulonDB RegulonDB 10.9: Gene Sequence
cyoE gene sequence


Size: 891        A: 159  T: 253  G: 265  C: 214

Fasta

 

>cyoE E. coli K12. Version NC_000913.3 GI:556503834
atgatgtttaagcaatacctgcaagtaacgaaaccaggcatcatctttggcaacctgatc
tcggtgattgggggattcctgctggcctcaaagggcagcattgattatcccctgtttatc
tacacgctggttggggtgtcactggttgtggcgtcgggttgtgtgtttaacaactacatc
gacagggatatcgacagaaagatggaaaggacgaagaatcgggtgctggtgaaaggcctg
atctctcctgctgtctcgctggtgtacgccacgttgctgggtattgctggctttatgctg
ctgtggtttggcgcgaatccgctggcctgctggctgggggtgatgggctttgtggtttat
gtcggcgtttatagcctgtacatgaaacgccactctgtctacggcacgttgattggttcg
ctctccggcgctgcgccgccggtgatcggctactgtgcggtaaccggtgagttcgatagc
ggcgcagcgatcctgctggctatcttcagcctgtggcagatgcctcactcctatgccatc
gccattttccgctttaaggattaccaggcggcaaacattccggtattgccagtggtaaaa
ggcatttcggtggcgaagaatcacatcacgctgtatatcatcgcctttgccgttgccacg
ctgatgctctctcttggcggttacgctgggtataaatatctggtggtcgccgcggcggtt
agcgtctggtggttaggtatggctctgcgcggttataaagttgctgatgacagaatctgg
gcgcgcaagctgttcggcttctctatcatcgccatcactgccctctcggtgatgatgtcc
gttgattttatggtaccggactcgcatacgctgctggctgctgtgtggtaa
              
                            

Download fasta file
RegulonDB