RegulonDB RegulonDB 10.9: Gene Sequence
cysA gene sequence


Size: 1098        A: 224  T: 230  G: 339  C: 305

Fasta

 

>cysA E. coli K12. Version NC_000913.3 GI:556503834
atgagcattgagattgccaatattaagaagtcgtttggtcgcacccaggtgctgaacgat
atctcactggatattccttcaggtcagatggtcgcgttgctggggccgtccggttccggg
aaaaccacgctgctgcgcattatcgccgggctggagcatcaaaccagcgggcatattcgc
ttccacggcaccgacgtgagccgcctgcacgcacgtgatcgtaaagtcggtttcgtgttc
cagcattacgcgctgttccgccatatgacggtgttcgacaatatcgcttttggcctgacg
gtgctgccgcgtcgcgagcgcccgaatgccgcagccatcaaagcgaaagtgacaaaattg
ctggaaatggtccagcttgcccatctggcggatcgttatccggcgcagctttccggcggc
cagaaacagcgcgtggcgctggcgcgcgcgctggctgtggaaccgcaaattctgctgctt
gatgaaccgtttggcgcgctggatgcgcaggtgcgtaaagagctgcgtcgctggctgcgt
caactccatgaagaactaaaattcaccagcgtttttgtgacccacgatcaggaagaagcg
accgaagtagctgatcgtgtagttgtgatgagccagggcaatattgaacaggctgacgcg
ccggatcaggtatggcgcgaaccggcgacccgttttgtgctcgaatttatgggcgaagtg
aaccgcctgcagggaaccattcgcggcgggcagttccatgttggcgcgcatcgctggccg
ctgggctacacacctgcgtatcaggggccggtggatctcttcctgcgcccttgggaagtg
gatatcagccgccgtaccagcctcgattcgccgctgccggtacaggtactggaagccagc
ccgaaaggtcactacacccaattagtggtgcagccgctggggtggtacaacgaaccgctg
acggtcgtgatgcatggcgacgatgccccgcagcgtggcgagcgtttattcgttggtctg
caacatgcgcggctgtataacggcgacgagcgtatcgaaacccgcgatgaggaacttgct
ctcgcacaaagcgcctga
              
                            

Download fasta file
RegulonDB