RegulonDB RegulonDB 10.10: Gene Sequence
cysD gene sequence


Size: 909        A: 229  T: 198  G: 253  C: 229

Fasta

 

>cysD E. coli K12. Version NC_000913.3 GI:556503834
atggatcaaatacgacttactcacctgcggcaactggaggcggaaagcatccacattatt
cgcgaggtggcggcagaattctcaaatccggtgatgctctactctatcggtaaagattcc
agcgtcatgctgcatctggcgcgcaaggcgttttatccaggtacgctgcctttcccgttg
ctgcatgtcgataccggctggaaattccgcgagatgtatgagttccgcgatcgtactgct
aaagcctacggctgcgaactgctggtgcataaaaacccggaaggcgtggcgatggggatt
aatccattcgtgcacggcagcgcgaaacataccgatattatgaaaactgaaggcctgaaa
caggcgctgaacaaatacggttttgatgccgccttcggtggtgcgcgccgtgacgaagag
aaatcccgcgctaaagagcgaatttactctttccgtgaccgcttccatcgctgggatccg
aaaaatcagcgcccggagctgtggcacaactacaacgggcaaattaacaaaggcgaaagc
atccgcgtcttcccgctctctaactggaccgagcaggatatctggcaatacatctggctg
gaaaatatcgacattgttccgctatatctcgctgcggaacgtccggttctggaacgcgac
ggtatgttgatgatgattgatgacaaccgtatcgacctgcaaccgggcgaagtgattaaa
aaacggatggtgcgtttccgtacgctgggctgctggccgctgaccggtgcggtggagtca
aatgcacaaacactgccggaaatcatcgaagagatgctggtttccaccaccagtgaacgt
cagggccgcgtgattgaccgcgaccaggcggggtctatggagctgaaaaaacgtcagggg
tatttttaa
              
                            

Download fasta file
RegulonDB