RegulonDB RegulonDB 10.10: Gene Sequence
cysG gene sequence


Size: 1374        A: 315  T: 308  G: 404  C: 347

Fasta

 

>cysG E. coli K12. Version NC_000913.3 GI:556503834
gtggatcatttgcctatattttgccaattacgcgatcgcgactgtctgattgtcggcggt
ggtgatgtcgcggaacgcaaagcaaggttgctgttagacgcaggcgctcgcttaacggtg
aatgcattagcgtttattccacagttcaccgcatgggcagatgcaggcatgttaaccctc
gtcgaagggccatttgatgaaagccttctcgacacctgctggctggcgattgcagcgacg
gatgatgacgcgcttaaccagcgcgtcagcgaagccgctgaagctcgtcgcatcttctgt
aacgtggtcgatgcgccgaaagccgccagctttattatgccgtcgattattgaccgctca
ccgctcatggtagcggtctcctctggcggcacctctccggttctggcacgcctgttgcgc
gaaaaacttgaatcactgctgccgttacatctgggccaggtagcgaaatacgccgggcaa
ttacgcgggcgagtgaaacaacagttcgccacgatgggtgagcgtcgccgtttctgggag
aaattgttcgttaacgaccgcctggcgcagtcgctggcaaacaacgatcagaaagccatt
actgaaacgaccgaacagttaatcaacgaaccgctcgaccatcgcggtgaagtggtgctg
gttggtgcaggtccgggcgatgccgggctgctgacactgaaaggactgcaacaaattcag
caggcagatgtggtggtctacgaccgtctggtttctgacgatattatgaatctggtacgc
cgcgatgcggaccgtgttttcgtcggcaaacgcgcgggataccactgcgtaccccaggaa
gagattaaccagatcctgctgcgggaagcgcaaaaaggcaaacgcgtggtgcggctgaaa
ggtggcgatccgtttatttttggccgtggtggcgaagagctggaaacactgtgcaacgcg
ggtattccgttctcggtggttccgggtattaccgcagcttctggttgctctgcctattcg
ggtattccactcacgcatcgcgattatgcccagagcgtacgcttaattaccggacactta
aaaaccggtggcgagctggactgggaaaacctggcggcagaaaaacagacgctggtgttc
tatatggggttgaatcaggccgcgactattcagcaaaagctgattgaacacggaatgcca
ggcgaaatgccggtggcaattgtcgaaaacggtacggcagtcacgcagcgcgtgattgac
ggtacgctcacacagctgggagaactggcgcagcaaatgaacagtccatcgctaattatt
attggtcgggttgttggcctgcgcgataaactgaactggttctccaaccattaa
              
                            

Download fasta file
RegulonDB