RegulonDB RegulonDB 10.9: Gene Sequence
cysJ gene sequence


Size: 1800        A: 417  T: 374  G: 511  C: 498

Fasta

 

>cysJ E. coli K12. Version NC_000913.3 GI:556503834
atgacgacacaggtcccaccttccgcgttgcttccgttgaacccggagcaactggcacgc
cttcaggcggccacgaccgatttaactcccacccagcttgcctgggtttctggctatttc
tggggcgtactcaatcagcagcctgctgcgcttgcagcgacgccagcgccagccgcagaa
atgccgggtataactattatctccgcctcgcaaaccggcaatgcgcgccgggttgctgaa
gcattacgtgatgatttattagcagcaaaactgaacgttaagctggtgaacgcgggcgac
tataaattcaaacaaatcgccagcgaaaaactgctcatcgtagtgacgtcaacgcaaggg
gaaggggaaccgccggaagaagccgtcgcgctgcataagttcctgttctccaaaaaagcg
ccaaagctggaaaacaccgcgtttgccgtgtttagcctcggcgatagctcttatgaattt
ttctgccagtccgggaaagatttcgacagcaagctggcggaactgggtggtgaacgcctg
ctcgaccgtgtcgatgccgatgttgaataccaggctgctgccagcgagtggcgcgcccgc
gtggttgatgcgcttaaatcgcgtgcgcctgtcgcggcaccttcgcaatccgtcgctact
ggcgcggtaaatgaaatccacaccagcccgtacagcaaagacgcgccgctggtggctagc
ctctctgttaaccagaaaattaccgggcgtaactctgaaaaagacgttcgccatatcgaa
attgacttaggtgactcgggcatgcgttaccagccgggtgacgcgctgggcgtctggtat
cagaacgatccggcactggtgaaagaacttgtcgaactgctgtggctgaaaggcgatgaa
cctgtcaccgtcgagggcaaaacgttgcctctgaacgaagcgctacagtggcacttcgaa
ctgaccgtcaacaccgccaacattgttgagaattacgccacgcttacccgcagtgaaaca
ctgctgccgctggtgggcgataaagcgaagttacagcattacgccgcgacgacgccgatt
gttgacatggtgcgtttctccccggcacagcttgatgccgaagcgctaattaatctgctg
cgcccgctgacgccgcgtctgtattccatcgcctcctcgcaggcggaagtcgagaacgaa
gtacacgtcaccgttggtgtggtgcgttacgacgtggaaggccgcgcccgtgccggtggt
gcctccagcttcctcgctgaccgcgtggaagaagagggcgaagtccgcgtatttatcgaa
cataacgataacttccgcctgccagccaatccagaaaccccggtgattatgattggccca
ggcaccggtattgcgccgttccgcgcctttatgcagcaacgcgccgccgacgaagcgcca
ggtaaaaactggctgttctttggtaatccgcactttacggaagacttcctgtaccaggtg
gagtggcagcgctacgtcaaagatggcgtgctgacacgtatcgatcttgcctggtcgcgc
gatcaaaaagaaaaagtttacgtacaagacaaactgcgcgaacagggcgcggagctgtgg
cgctggatcaatgatggtgcccacatttatgtctgcggcgacgctaatcgcatggcgaaa
gacgttgagcaggcacttctggaagtgattgccgaatttggtggcatggacaccgaagcg
gcggatgaatttttaagtgagctgcgcgtagagcgccgttatcagcgagatgtctactaa
              
                            

Download fasta file
RegulonDB