RegulonDB RegulonDB 10.9: Gene Sequence
cysK gene sequence


Size: 972        A: 263  T: 220  G: 255  C: 234

Fasta

 

>cysK E. coli K12. Version NC_000913.3 GI:556503834
atgagtaagatttttgaagataactcgctgactatcggtcacacgccgctggttcgcctg
aatcgcatcggtaacggacgcattctggcgaaggtggaatctcgtaaccccagcttcagc
gttaagtgccgtatcggtgccaacatgatttgggatgccgaaaagcgcggcgtgctgaaa
ccaggcgttgaactggttgaaccgaccagcggtaataccgggattgcactggcctatgta
gctgccgctcgcggttacaaactcaccctgaccatgccagaaaccatgagtattgaacgc
cgcaagctgctgaaagcgttaggtgcaaacctggtgctgacggaaggtgctaaaggcatg
aaaggcgcaatccaaaaagcagaagaaattgtcgccagcaatccagagaaatacctgctg
ctgcaacaattcagcaatccggcaaaccctgaaattcacgaaaagaccaccggtccggag
atatgggaagataccgacggtcaggttgatgtatttattgctggcgttgggactggcggt
acgctgactggcgtcagccgctacattaaaggcaccaaaggcaagaccgatcttatctct
gtcgccgttgagccaaccgattctccagttatcgcccaggcgctggcaggtgaagagatt
aaacctggcccgcataaaattcagggtattggcgctggttttatcccggctaacctcgat
ctcaagctggtcgataaagtcattggcatcaccaatgaagaagcgatttctaccgcgcgt
cgtctgatggaagaagaaggtattcttgcaggtatctcttctggagcagctgttgccgcg
gcgttgaaactacaagaagatgaaagctttaccaacaagaatattgtggttattctacca
tcatcgggtgagcgttatttaagcaccgcattgtttgccgatctcttcactgagaaagaa
ttgcaacagtaa
              
                            

Download fasta file
RegulonDB