RegulonDB RegulonDB 10.9: Gene Sequence
cysM gene sequence


Size: 912        A: 214  T: 183  G: 292  C: 223

Fasta

 

>cysM E. coli K12. Version NC_000913.3 GI:556503834
gtgagtacattagaacaaacaataggcaatacgcctctggtgaagttgcagcgaatgggg
ccggataacggcagtgaagtgtggttaaaactggaaggcaataacccggcaggttcggtg
aaagatcgtgcggcactttcgatgatcgtcgaggcggaaaagcgcggggaaattaaaccg
ggtgatgtcttaatcgaagccaccagtggtaacaccggcattgcgctggcaatgattgcc
gcgctgaaaggctatcgcatgaaattgctgatgcccgacaacatgagccaggaacgccgt
gcggcgatgcgtgcttatggtgcggaactgattcttgtcaccaaagagcagggcatggaa
ggtgcgcgcgatctggcgctggagatggcgaatcgtggcgaaggaaagctgctcgatcag
ttcaataatcccgataacccttatgcgcattacaccaccactgggccggaaatctggcag
caaaccggcgggcgcatcactcattttgtctccagcatggggacgaccggcactatcacc
ggcgtctcacgctttatgcgcgaacaatccaaaccggtgaccattgtcggcctgcaaccg
gaagagggcagcagcattcccggcattcgccgctggcctacggaatatctgccggggatt
ttcaacgcttctctggtggatgaggtgctggatattcatcagcgcgatgcggaaaacacc
atgcgcgaactggcggtgcgggaaggaatattctgtggcgtcagctccggcggcgcggtt
gccggagcactgcgggtggcaaaagctaaccctgacgcggtggtggtggcgatcatctgc
gatcgtggcgatcgctacctttctaccggggtgtttggggaagagcattttagccagggg
gcggggatttaa
              
                            

Download fasta file
RegulonDB