RegulonDB RegulonDB 10.9: Gene Sequence
cysP gene sequence


Size: 1017        A: 269  T: 201  G: 280  C: 267

Fasta

 

>cysP E. coli K12. Version NC_000913.3 GI:556503834
atggccgttaacttactgaaaaagaactcactcgcgctggtcgcttctctgctgctggcg
ggccatgtacaggcaacggaactgctgaacagttcttatgacgtctcccgcgagctgttt
gccgccctgaatccgccgtttgagcaacaatgggcaaaagataacggcggcgacaaactg
acgataaaacaatctcatgccgggtcatcaaaacaggcgctggcgattttacagggctta
aaagccgacgttgtcacttataaccaggtgaccgacgtacaaatcctgcacgataaaggc
aagctgatcccggccgactggcagtcgcgcctgccgaataatagctcgccgttctactcc
accatgggcttcctggtgcgtaagggtaacccgaagaatatccacgattggaacgacctg
gtgcgctccgacgtgaagctgattttcccgaacccgaaaacgtcgggtaacgcgcgttat
acctatctggcggcatggggcgcagcggataaagctgacggtggtgacaaaggcaaaacc
gaacagtttatgacccagttcctgaaaaacgttgaagtgttcgatactggcggtcgtggc
gcgaccaccacttttgccgagcgcggcctgggcgatgtgctgattagcttcgaatcggaa
gtgaacaacatccgtaaacagtatgaagcgcagggctttgaagtggtgattccgaaaacc
aacattctggcggaattcccggtggcgtgggttgataaaaacgtgcaggccaacggtacg
gaaaaagccgccaaagcctatctgaactggctctatagcccgcaggcgcaaaccatcatc
accgactattactaccgcgtgaataacccggaggtgatggacaaactgaaagacaaattc
ccgcagaccgagctgttccgcgtggaagacaaatttggctcctggccggaagtgatgaaa
acccacttcaccagcggcggcgagttagacaagctgttagcggcggggcgtaactga
              
                            

Download fasta file
RegulonDB