RegulonDB RegulonDB 10.9: Gene Sequence
cysU gene sequence


Size: 834        A: 134  T: 231  G: 259  C: 210

Fasta

 

>cysU E. coli K12. Version NC_000913.3 GI:556503834
atgtttgctgtctcctccagacgcgtgctgccgggctttaccttaagcctcggcaccagt
ctgctgtttgtgtgcctgattttgctgctgccgctctccgcgctggtgatgcaactggcc
cagatgagctgggcgcagtactgggaggtgatcaccaacccgcaggtggtcgcggcctac
aaagtaacgctgctgtcggcgtttgtggcatcgatttttaacggcgttttcggtctgctg
atggcgtggatcctaacccgctatcgcttcccaggccgcacgctgcttgatgcgctgatg
gatttaccctttgcgctgccaacggctgtcgccggtttaacgctggcctcgctcttttcc
gtaaacggtttttacggtgaatggctggcgaagtttgatatcaaagtcacctatacatgg
ctggggattgcggtggctatggcctttaccagcattccgtttgtggtgcgtaccgtgcag
ccggtgctggaagagttaggcccggaatatgaagaagcggcggaaacgcttggtgcaacg
cgctggcagagtttctgcaaagtggtgctgccggagctttctccggcgctggtggcgggc
gtggcgctgtcgtttacccgtagtcttggtgaatttggcgcggtgatttttatcgccgga
aatatcgcgtggaagacggaagtgacgtcgctgatgatttttgtgcgcttacaggagttt
gattacccggcagcgagcgcgattgcttcggtgatcctcgcggcatctctgctgctgctg
ttctcaattaacactctgcaaagtcgctttggtcggcgtgtggtaggtcattaa
              
                            

Download fasta file
RegulonDB