RegulonDB RegulonDB 10.9: Gene Sequence
cysW gene sequence


Size: 876        A: 156  T: 224  G: 271  C: 225

Fasta

 

>cysW E. coli K12. Version NC_000913.3 GI:556503834
atggcggaagttacccaattgaagcgttatgacgcgcgcccgattaactggggcaaatgg
tttctgattggcatcgggatgctggtttcggcgttcatcctgctggtgccgatgatttac
atcttcgtgcaggcattcagcaaggggctgatgccggttttacagaatctggccgatccg
gacatgctgcacgccatctggctgacggtgatgatcgcgctgattgccgtaccggtaaac
ctggtgttcggcattctgctggcctggctggtgacgcgctttaacttccctggacgccag
ttactgctgacgctactggacattccgtttgccgtatcgccggtggttgccggtctggtg
tatttgctgttctacggctctaacggcccgctcggcggttggctcgacgagcataacctg
caaattatgttctcctggccgggaatggtgctggtcaccatcttcgtgacgtgtccgttt
gtggtgcgcgaactggtgccggtgatgttaagccagggcagccaggaagacgaagcggcg
attttgcttggcgcgtccggctggcagatgttccgtcgcgtcacattaccgaacatccgc
tgggcgctgctttatggcgtggtgttgaccaacgcccgcgcaattggcgagtttggcgcg
gtgtcggtggtttccggctcgattcgcggcgaaaccctgtcgctgccgttacagattgaa
ttgctggagcaggactacaacaccgtcggctcctttaccgctgcggcgctgttaacgctg
atggcgattatcaccctgtttttaaaaagtatgttgcagtggcgcctggagaatcaggaa
aaacgcgcacagcaggaggaacatcatgagcattga
              
                            

Download fasta file
RegulonDB