RegulonDB RegulonDB 10.9: Gene Sequence
dacA gene sequence


Size: 1212        A: 312  T: 302  G: 302  C: 296

Fasta

 

>dacA E. coli K12. Version NC_000913.3 GI:556503834
atgaataccattttttccgctcgtatcatgaagcgcctggcgctcaccacggctctttgc
acagcctttatctctgctgcacatgccgatgacctgaatatcaaaactatgatcccgggt
gtaccgcagatcgatgcggagtcctacatcctgattgactataactccggcaaagtgctc
gccgaacagaacgcagatgtccgccgcgatcctgccagcctgaccaaaatgatgaccagt
tacgttatcggccaggcaatgaaagccggtaaatttaaagaaactgatttagtcactatc
ggcaacgacgcatgggccaccggtaacccggtgtttaaaggttcttcgctgatgttcctc
aaaccgggcatgcaggttccggtttctcagctgatccgcggtattaacctgcaatcgggt
aacgatgcttgtgtcgccatggccgattttgccgctggtagccaggacgcttttgttggc
ttgatgaacagctacgttaacgcactgggcctgaaaaatacccacttccagacggtacat
ggtctggatgctgatggtcagtacagctccgcgcgagatatggcgctgatcggccaggca
ttgatccgtgacgtaccgaatgaatactcgatctataaagaaaaagaatttacgtttaac
ggtattcgccagctgaaccgtaacggcctgttatgggataacagcctgaatgtcgacggc
atcaaaaccggacacactgacaaagcaggttacaaccttgttgcttctgcgactgaaggc
cagatgcgcttgatttctgcggtaatgggcggacgtacttttaaaggccgtgaagccgaa
agtaaaaaactgctaacctggggcttccgtttctttgaaaccgttaacccactgaaagta
ggtaaagagttcgcctctgaaccggtttggtttggtgattctgatcgcgcttcgttaggg
gttgataaagacgtgtacctgaccattccgcgtggtcgcatgaaagatctgaaagccagc
tatgtgctgaacagcagtgaattgcatgcgccgctgcaaaagaatcaggtcgtcggaact
atcaacttccagcttgatggcaaaacgatcgagcaacgcccgctggttgtgttgcaagaa
atcccggaaggtaacttcttcggcaaaatcattgattacattaaattaatgttccatcac
tggtttggttaa
              
                            

Download fasta file
RegulonDB