RegulonDB RegulonDB 10.9: Gene Sequence
dacC gene sequence


Size: 1203        A: 290  T: 291  G: 351  C: 271

Fasta

 

>dacC E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaatactcctctctccttcgtggtcttgcagcgggttctgcatttttattcctt
tttgccccaacggcattcgcggcggaacaaaccgttgaagcgccgagcgtggatgcgcgt
gcatggattttaatggattacgccagcggtaaagtgctggcagaaggcaatgcggatgag
aaactggatcccgcgagcctgactaaaatcatgaccagctatgtggttgggcaggcgctt
aaggccgataagattaaactcaccgatatggtgacggtcggtaaagatgcctgggcgacg
ggaaatccggcactgcgtggttcatcggtaatgttcctcaaaccgggcgatcaggtttcg
gtggcagacttgaacaaaggtgtgattatccagtccggtaatgacgcctgtattgcgctg
gctgattacgttgccgggagccaggagtcatttattggtctgatgaatggttatgccaaa
aaactgggtctgaccaacactaccttccagacggtgcacggcctggatgcgccggggcag
ttcagcaccgcgcgcgatatggcattgctgggtaaagcattgatccacgatgtgccggaa
gagtacgccattcataaagagaaagagttcaccttcaacaaaattcgtcagcctaaccgt
aaccgtctgctgtggagcagcaatctgaatgttgatggcatgaagacaggaaccacggca
ggcgcgggatataatctggttgcttcggctacccagggcgatatgcgtttaatctccgta
gtgttgggggcgaaaaccgaccgtatccgttttaatgagtctgagaaattattgacctgg
ggtttccgcttctttgaaaccgtgacgccaattaaacctgatgccacctttgtgactcag
cgcgtctggtttggtgataagagcgaagtgaatctcggggcaggtgaagcgggctcagtg
accataccgcgtgggcagctgaaaaacctgaaagcgagttatacgttaacggaaccgcag
cttaccgcaccgctgaaaaaaggtcaggttgtcgggaccattgatttccagcttaacggt
aaatccattgagcagcgtccgctgatcgtgatggaaaatgtggaagagggcggattcttt
ggtcgggtgtgggatttcgtgatgatgaaattccatcagtggttcggcagctggttctct
taa
              
                            

Download fasta file
RegulonDB