RegulonDB RegulonDB 10.9: Gene Sequence
dapD gene sequence


Size: 825        A: 199  T: 188  G: 234  C: 204

Fasta

 

>dapD E. coli K12. Version NC_000913.3 GI:556503834
atgcagcagttacagaacattattgaaaccgcttttgaacgccgtgccgagatcacgcca
gccaatgcagacaccgttacccgcgaagcggtaaatcaggtgatcgccctgctggattcc
ggcgcactgcgtgtagcggaaaaaattgacggtcagtgggtgacgcatcagtggttgaaa
aaagcggtgctgctctctttccgtattaatgataatcaggtgatcgaaggggcagaaagc
cgctacttcgacaaagtgccgatgaaattcgccgactacgacgaagcacgtttccagaaa
gaaggcttccgcgttgtgccaccagcggcggtacgtcagggtgcgtttattgcccgtaac
accgtgctgatgccgtcttacgtcaacatcggcgcatatgttgatgaaggcaccatggtt
gatacctgggcgaccgtcggttcttgtgcgcagattggtaaaaacgtccacctttccggt
ggcgtgggcatcggcggcgtgctggaaccgctgcaggctaacccaaccatcattgaagat
aattgcttcatcggcgcgcgctctgaagtggttgaaggggtgattgtcgaagaaggttcc
gtcatttccatgggcgtatacattggtcagagcacccgtatttacgaccgtgaaaccggc
gaaatccactacggtcgcgttccggcggggtctgtggttgtttcaggtaatctgccgtca
aaagatggcaaatacagcctctactgtgcggttatcgttaagaaagttgacgcgaaaact
cgcggcaaagtcggcattaacgaactgctgcgtaccatcgactaa
              
                            

Download fasta file
RegulonDB