RegulonDB RegulonDB 10.9: Gene Sequence
dapE gene sequence


Size: 1128        A: 251  T: 274  G: 325  C: 278

Fasta

 

>dapE E. coli K12. Version NC_000913.3 GI:556503834
atgtcgtgcccggttattgagctgacacaacagcttattcgccgcccttccctgagtcct
gatgatgcaggatgccaggctttgttgattgaacgtttgcaggcgatcggttttaccgtt
gaacgcatggactttgccgatacgcagaatttttgggcatggcgtgggcagggtgaaacg
ttagcctttgccgggcataccgacgtggtgccgcctggcgacgccgatcgttggatcaat
cccccgtttgaacccaccattcgtgacggcatgttattcgggcgcggtgcggcagatatg
aaaggctcgctggcggcgatggtggtggcggcagaacgttttgtcgcacaacatcccaac
catacggggcgactggcatttctgatcacctctgatgaagaagccagtgcccacaacggt
acggtaaaagtcgtcgaagcgttaatggcacgtaatgagcgtctcgattactgcctggtt
ggcgaaccgtcgagtatcgaagtggtaggtgatgtggtgaaaaatggtcgtcgcggatca
ttaacctgcaaccttaccattcatggcgttcaggggcatgttgcctacccacatctggct
gacaatccggtacatcgcgcagcacctttccttaatgaattagtggctattgagtgggat
cagggcaatgaattcttcccggcgaccagtatgcagattgccaatattcaggcgggaacg
ggcagtaacaacgttattccgggtgaactgtttgtgcagtttaacttccgcttcagcacc
gaactgactgatgagatgatcaaagcgcaggtgcttgccctgcttgaaaaacatcaactg
cgctatacggtggattggtggctttccgggcagccatttttgaccgcgcgcggtaaactg
gtggatgcggtcgttaacgcggttgagcactataatgaaattaaaccgcagctactgacc
acaggcggaacgtccgacgggcgctttattgcccgcatgggggcgcaggtggtggaactc
gggccggtcaatgccactattcataaaattaatgaatgtgtgaacgctgccgacctgcag
ctacttgcccgtatgtatcaacgtatcatggaacagctcgtcgcctga
              
                            

Download fasta file
RegulonDB