RegulonDB RegulonDB 10.9: Gene Sequence
dbpA gene sequence


Size: 1374        A: 321  T: 339  G: 390  C: 324

Fasta

 

>dbpA E. coli K12. Version NC_000913.3 GI:556503834
gtgaccgctttttctaccctgaatgttttgcctcccgcccaactcacgaaccttaatgag
ttgggttatttaaccatgacgccggtgcaggccgccgcgcttccggcgatccttgccgga
aaagatgttcgcgtgcaggcgaaaaccggcagcggcaaaacggcggcttttggcctcggc
ttgttacagcaaattgatgcgtcgctatttcaaacccaggctttagtgctgtgtcctacg
cgtgaactggcggatcaggtggcaggtgaattgcgtcggctggcgcgttttctgccaaat
accaaaattttgacgttgtgcggtggtcaaccgttcggtatgcagcgtgattcgttgcaa
catgcgccgcatattatcgtggcaacgccggggcgtttgctggatcacctgcaaaaaggc
acggtatcactggatgcgttgaatacgctggtgatggatgaggccgaccgcatgctggat
atgggatttagcgatgccattgatgatgtcatccgttttgcgcctgcatctcgacagacg
cttctgttttcggcaacctggccggaagccatcgctgcaatcagcggacgagtgcaacgc
gatcctttggcgattgaaattgactcaacagatgctttgccacccattgaacaacaattt
tatgagacatccagcaaaggcaaaattcctctgttgcaacggttattaagcttgcatcag
ccatcctcttgcgtggtgttttgcaataccaaaaaagattgccaggctgtctgcgacgcg
ctgaatgaagtagggcaaagtgcattgtcattacacggcgatttggagcaacgcgatcgc
gatcagaccctggtacgttttgctaacggtagcgcccgtgtactggtcgcgactgatgtt
gctgcgcgtggtctggatattaaatcgcttgagctggtggtgaactttgagctggcgtgg
gaccctgaagttcatgtacatcgcatcggtcgtacagctcgtgcaggaaatagcggtctg
gcgatcagtttctgtgctccggaagaagcacagcgggccaatatcatttctgacatgttg
cagataaaacttaactggcaaacgccgccagctaatagttccattgcgacgctggaagca
gaaatggcaacgttgtgtatcgatggcgggaaaaaagccaaaatgcgcccgggtgatgta
ttaggtgcactgacaggagatatcgggcttgatggcgcagatattggcaaaatcgccgtg
catccggcgcatgtctatgtcgcggtccgtcaggctgttgctcataaagcatggaaacag
ttacagggcgggaagattaaaggaaaaacgtgccgggtgcggttattaaaataa
              
                            

Download fasta file
RegulonDB