RegulonDB RegulonDB 10.9: Gene Sequence
dcm gene sequence


Size: 1419        A: 353  T: 326  G: 393  C: 347

Fasta

 

>dcm E. coli K12. Version NC_000913.3 GI:556503834
atgcaggaaaatatatcagtaaccgattcatacagcaccgggaatgccgcacaggcaatg
ctggagaaactgctgcaaatttatgatgttaaaacgttggtggcgcagcttaatggtgta
ggtgagaatcactggagcgcggcaattttaaaacgtgcgctggcgaatgactcggcatgg
caccgtttaagtgagaaagagttcgcccatctgcaaacgttattacccaaaccaccggca
catcatccgcattatgcgtttcgctttatcgatctattcgccggaattggcggcatccgt
cgcggttttgaatcgattggcggacagtgcgtgtttaccagcgaatggaacaaacatgcg
gtacgcacttataaagccaaccattattgcgatccggcgacgcatcattttaatgaagat
atccgcgacatcaccctcagccataaagaaggcgtgagtgatgaggcggcggcggaacat
attcgtcaacacattcctgaacacgatgttttactggccggtttcccttgtcagccattt
tcgctggctggcgtatcgaaaaagaactcgctcgggcgggcgcacggttttgcctgcgat
acccagggcacgctgttttttgatgtggtacgcattatcgacgcgcgtcgtccggcgatg
tttgtgctcgaaaacgtcaaaaacctgaaaagtcacgaccagggtaaaacgttccgcatc
atcatgcagacgctggacgaactgggctatgacgtggctgatgcagaagataatgggcca
gacgatccgaaaatcatcgacggcaaacattttctgccgcagcaccgtgaacgcatcgtg
ctggtgggttttcgtcgcgatctgaatctgaaagccgattttaccctgcgtgatatcagc
gaatgtttccctgcgcagcgagtgacgctggcgcagctgttggacccgatggtcgaggcg
aaatatatcctgacgccggtgctgtggaagtacctctatcgatatgcgaaaaaacatcag
gcgcgcggtaacggcttcggttatggaatggtttatccgaacaatccgcaaagcgtcacg
cgtacgctgtctgcgcgttattacaaagatggcgcggaaattttaatcgatcgcggctgg
gatatggccacgggtgagaaagactttgacgatccgctgaatcagcaacatcgtccacgt
cggttaacgcctcgggaatgcgcgcgcttaatgggttttgaagcgccgggagaagcgaaa
ttccgtattccggtttcggacactcaggcctatcgccagttcggtaactcggtggtcgtg
ccggtctttgccgcggtggcaaaactgcttgagccaaaaatcaaacaggcggtggcgttg
cgtcagcaagaggcacaacatggccgacgttcacgataa
              
                            

Download fasta file
RegulonDB