RegulonDB RegulonDB 10.8: Gene Sequence
dcp gene sequence


Size: 2046        A: 518  T: 506  G: 544  C: 478

Fasta

 

>dcp E. coli K12. Version NC_000913.3 GI:556503834
atgacaacaatgaatcctttccttgtgcaaagcacactgccgtatctggctccccatttt
gatcaaattgccaatcatcactatcgcccggcattcgatgagggaatgcagcaaaagcgg
gcagaaattgctgccatcgcgcttaacccgcaaatgcctgatttcaacaatactattctg
gcactggaacaaagcggagaattacttacccgcgttaccagcgtcttttttgcgatgact
gcggcgcataccaatgatgaattacagcgtcttgacgagcagttttccgctgaactggcg
gaactggctaatgatatctatctgaacggtgaattattcgcgcgggtagatgctgtctgg
cagcgccgtgaatccctggggcttgatagtgaatccatccgcctggtggaggtgattcat
caacgttttgtccttgccggagccaaacttgcgcaagctgataaagcaaaattaaaagta
ctgaatacagaagctgcgaccctgaccagccagtttaaccagcgattactggcagcaaat
aaatccggcggtctggttgtgaacgatatcgcgcagctggcaggaatgagtgagcaagag
attgcgctggcggcagaggcggctcgcgagaaaggtctggataacaaatggctgattccg
ctgctgaataccacccaacaaccggcgcttgccgaaatgcgcgatcgtgcgacgcgtgaa
aaactgtttattgcgggctggacgcgagcggaaaaaaatgatgccaatgatacccgcgct
atcattcaacgtctggtggagatccgtgcacaacaggcaacactacttggttttcctcat
tatgccgcatggaaaatcgccgatcagatggcaaaaacacctgaagcagcacttaacttt
atgcgggaaattgttccagcggcgcgtcaacgtgcgagcgatgaattagcctccatacag
gcggttatcgataagcagcagggcgggtttagcgcgcagccgtgggactgggcattttat
gcggaacaggtacggcgggagaaatttgatcttgatgaggcgcagctcaagccatatttt
gaattaaacacggtgttaaatgaaggtgtattctggaccgcgaatcagctcttcggtatt
aagtttgtcgaacgttttgatattcctgtctaccatcctgacgttcgtgtgtgggaaatt
tttgatcataatggcgtggggctggcgttattttacggtgatttcttcgcccgtgattca
aaaagcggcggtgcatggatgggcaattttgttgagcaatcaacgcttaataaaacacat
ccggtaatttataacgtctgcaattatcagaaacccgctgccggtgagcctgcgttgtta
ctctgggatgatgtcataaccttattccatgaatttggtcatacgctgcacggccttttt
gcccgccagcgttatgccacgctttccggcaccaacacgccgcgtgattttgtcgaattt
ccgtcgcaaatcaacgaacactgggcaacgcatccgcaggtattcgctcgctacgcccgg
cattatcagagcggggcagcaatgcctgacgaactgcaacagaaaatgcgtaatgccagc
ctgttcaacaaagggtatgagatgagcgaactgcttagcgccgcacttctcgatatgcgc
tggcattgcctggaagaaaacgaagcaatgcaggatgtcgatgattttgaattgcgggcg
ctggtggcggaaaatatggatcttcctgctataccgccacgctatcgcagcagttatttc
gcccatatttttggtggcggatatgctgcaggttattacgcttatctgtggacgcaaatg
ttggccgatgatggttatcagtggtttgttgagcagggcggattaacgcgtgaaaatggg
ctgcgttttcgcgaggcgatcctttccagaggtaacagcgaagatctggaacgcctgtat
cgacaatggcgcggtaaggcacctaagattatgccgatgctgcaacatcgtggcttgaac
atataa
              
                            

Download fasta file
RegulonDB