RegulonDB RegulonDB 10.10: Gene Sequence
ddlB gene sequence


Size: 921        A: 227  T: 219  G: 280  C: 195

Fasta

 

>ddlB E. coli K12. Version NC_000913.3 GI:556503834
atgactgataaaatcgcggtcctgttgggtgggacctccgctgagcgggaagtttctctg
aattctggcgcagcggtgttagccggactgcgtgaaggcggtattgacgcgtatcctgtc
gacccgaaagaagtcgacgtgacgcaactgaagtcgatgggctttcagaaagtgtttatc
gcgctacacggtcgcggcggtgaagatggtacgctgcaggggatgctcgagctgatgggc
ttgccttataccggaagcggagtgatggcatctgcgctttcaatggataaactacgcagc
aaacttctatggcaaggtgccggtttaccggtcgcgccgtgggtagcgttaacccgcgca
gagtttgaaaaaggcctgagcgataagcagttagcagaaatttctgctctgggtttgccg
gttatcgttaagccgagccgcgaaggttccagtgtgggaatgtcaaaagtagtagcagaa
aatgctctacaagatgcattaagattggcatttcagcacgatgaagaagtattgattgaa
aaatggctaagtgggccggagttcacggttgcgatactcggtgaagaaattttaccgtca
atacgtattcaaccgtccggaaccttctatgattatgaggcgaagtatctctctgatgag
acacagtatttctgccccgcaggtctggaagcgtcacaagaggccaatttgcaggcatta
gtgctgaaagcatggacgacgttaggttgcaaaggatggggacgtattgacgttatgctg
gacagcgatggacagttttatctgctggaagccaatacctcaccgggtatgaccagccac
agcctggtgccgatggcggcacgtcaggcaggtatgagcttctcgcagttggtagtacga
attctggaactggcggactaa
              
                            

Download fasta file
RegulonDB