RegulonDB RegulonDB 10.9: Gene Sequence
accD gene sequence


Size: 915        A: 206  T: 202  G: 283  C: 224

Fasta

 

>accD E. coli K12. Version NC_000913.3 GI:556503834
atgagctggattgaacgaattaaaagcaacattactcccacccgcaaggcgagcattcct
gaaggggtgtggactaagtgtgatagctgcggtcaggttttataccgcgctgagctggaa
cgtaatcttgaggtctgtccgaagtgtgaccatcacatgcgtatgacagcgcgtaatcgc
ctgcatagcctgttagatgaaggaagccttgtggagctgggtagcgagcttgagccgaaa
gatgtgctgaagtttcgtgactccaagaagtataaagaccgtctggcatctgcgcagaaa
gaaaccggcgaaaaagatgcgctggtggtgatgaaaggcactctgtatggaatgccggtt
gtcgctgcggcattcgagttcgcctttatgggcggttcaatggggtctgttgtgggtgca
cgtttcgtgcgtgccgttgagcaggcgctggaagataactgcccgctgatctgcttctcc
gcctctggtggcgcacgtatgcaggaagcactgatgtcgctgatgcagatggcgaaaacc
tctgcggcactggcaaaaatgcaggagcgcggcttgccgtacatctccgtgctgaccgac
ccgacgatgggcggtgtttctgcaagtttcgccatgctgggcgatctcaacatcgctgaa
ccgaaagcgttaatcggctttgccggtccgcgtgttatcgaacagaccgttcgcgaaaaa
ctgccgcctggattccagcgcagtgaattcctgatcgagaaaggcgcgatcgacatgatc
gtccgtcgtccggaaatgcgcctgaaactggcgagcattctggcgaagttgatgaatctg
ccagcgccgaatcctgaagcgccgcgtgaaggcgtagtggtacccccggtaccggatcag
gaacctgaggcctga
              
                            

Download fasta file
RegulonDB