RegulonDB RegulonDB 10.9: Gene Sequence
dedD gene sequence


Size: 663        A: 159  T: 126  G: 213  C: 165

Fasta

 

>dedD E. coli K12. Version NC_000913.3 GI:556503834
gtggcaagtaagtttcagaatcggttagtgggcacgatcgtgctggtggcgctgggggtg
attgtacttccagggctgctggacgggcagaaaaaacattatcaggatgagttcgcggct
atcccgctggtgccgaaagcgggcgatcgtgatgagcctgatatgatgccagccgccacc
caggcgttaccgacgcagccgccggaaggcgcagcggaagaggtgcgggcaggtgatgcc
gcagcaccgtcgctcgatccggccactattgcagccaataacaccgagtttgaaccggaa
cctgcaccggtcgccccaccgaagccgaaaccggtggagccgcctaaaccaaaggttgaa
gcaccacctgcgccgaagccagaaccgaagccggtcgtggaagaaaaagctgcaccgacg
ggtaaagcctatgttgtgcaactgggtgcgctgaaaaatgccgataaagtgaatgagatt
gtcggtaagctgcgcggtgccggttatcgggtttatacgtcgccatccacgccagtgcag
ggtaaaattacccgtattctggttgggccggatgcctcgaaagataagctgaaaggttcg
ctgggtgagttgaagcaactttctggcttaagtggcgtggtaatgggctatacgccgaat
taa
              
                            

Download fasta file
RegulonDB