RegulonDB RegulonDB 10.9: Gene Sequence
deoA gene sequence


Size: 1323        A: 304  T: 289  G: 388  C: 342

Fasta

 

>deoA E. coli K12. Version NC_000913.3 GI:556503834
ttgtttctcgcacaagaaattattcgtaaaaaacgtgatggtcatgcgctgagcgatgaa
gaaattcgtttctttatcaacggtattcgcgacaacactatctccgaagggcagattgcc
gccctcgcgatgaccattttcttccacgatatgacaatgcctgagcgtgtctcgctgacc
atggcgatgcgagattcaggaaccgttctcgactggaaaagcctgcatctgaatggcccg
attgttgataaacactccaccggtggcgtcggcgatgtgacttcgctgatgttggggccg
atggtcgcagcctgcggcggctatattccgatgatctctggtcgcggcctcggtcatact
ggcggtacgctcgacaaactggaatccatccctggcttcgacattttcccggatgacaac
cgtttccgcgaaattattaaagacgtcggcgtggcgattatcggtcagaccagttcactg
gctccggctgataaacgtttctacgcgacccgtgatattaccgcaaccgtggactccatc
ccgctgatcaccgcctctattctggcgaagaaacttgcggaaggtctggacgcgctggtg
atggacgtgaaagtgggtagcggcgcgtttatgccgacctacgaactctctgaagccctt
gccgaagcgattgttggcgtggctaacggcgctggcgtgcgcaccaccgcgctgctcacc
gacatgaatcaggtactggcctccagtgcaggtaacgcggttgaagttcgtgaagcggtg
cagttcctgacgggtgaatatcgtaacccgcgtctgtttgatgtcacgatggcgctgtgc
gtggagatgctgatctccggcaaactggcgaaagatgacgccgaagcgcgcgcgaaattg
caggcggtgctggacaacggtaaagcggcagaagtctttggtcgtatggtagcggcacaa
aaaggcccgaccgacttcgttgagaactacgcgaagtatctgccgacagcgatgctgacg
aaagcagtctatgctgataccgaaggttttgtcagtgaaatggatacccgcgcgctgggg
atggcagtggttgcaatgggcggcggacgccgtcaggcatctgacaccatcgattacagc
gtcggctttactgatatggcgcgtctgggcgaccaggtagacggtcagcgtccgctggcg
gttatccacgcgaaagacgaaaacaactggcaggaagcggcgaaagcggtgaaagcggca
attaaacttgccgataaagcaccggaaagcacaccaactgtctatcgccgtatcagcgaa
taa
              
                            

Download fasta file
RegulonDB