RegulonDB RegulonDB 10.9: Gene Sequence
deoB gene sequence


Size: 1224        A: 286  T: 273  G: 333  C: 332

Fasta

 

>deoB E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgtgcatttattatggtgctggactcattcggcatcggcgctacagaagatgca
gaacgctttggtgacgtcggggctgacaccctgggtcatatcgcagaagcttgtgccaaa
ggcgaagctgataacggtcgtaaaggcccgctcaatctgccaaatctgacccgtctgggg
ctggcgaaagcacacgaaggttctaccggtttcattccggcgggaatggacggcaacgct
gaagttatcggcgcgtacgcatgggcgcacgaaatgtcatccggtaaagataccccgtct
ggtcactgggaaattgccggtgtcccggttctgtttgagtggggatatttctccgatcac
gaaaacagcttcccgcaagagctgctggataaactggtcgaacgcgctaatctgccgggt
tacctcggtaactgccactcttccggtacggtcattctggatcaactgggcgaagagcac
atgaaaaccggcaagccgattttctatacctccgctgactccgtgttccagattgcctgc
catgaagaaactttcggtctggataaactctacgaactgtgcgaaatcgcccgtgaagag
ctgaccaacggcggctacaatatcggtcgtgttatcgctcgtccgtttatcggcgacaaa
gccggtaacttccagcgtaccggtaaccgtcacgacctggctgttgagccgccagcaccg
accgtgctgcagaaactggttgatgaaaaacacggccaggtggtttctgtcggtaaaatt
gcggacatctacgccaactgcggtatcaccaaaaaagtgaaagcgactggcctggacgcg
ctgtttgacgccaccatcaaagagatgaaagaagcgggtgataacaccatcgtcttcacc
aacttcgttgacttcgactcttcctggggccaccgtcgcgacgtcgccggttatgccgcg
ggtctggaactgttcgaccgccgtctgccggagctgatgtctctgctgcgcgatgacgac
atcctgatcctcaccgctgaccacggttgcgatccgacctggaccggtactgaccacacg
cgtgaacacattccggtactggtatatggcccgaaagtaaaaccgggctcactgggtcat
cgtgaaaccttcgcggatatcggccagactctggcaaaatattttggtacttctgatatg
gaatatggcaaagccatgttctga
              
                            

Download fasta file
RegulonDB