RegulonDB RegulonDB 10.9: Gene Sequence
deoC gene sequence


Size: 780        A: 196  T: 152  G: 223  C: 209

Fasta

 

>deoC E. coli K12. Version NC_000913.3 GI:556503834
atgactgatctgaaagcaagcagcctgcgtgcactgaaattgatggacctgaccaccctg
aatgacgacgacaccgacgagaaagtgatcgccctgtgtcatcaggccaaaactccggtc
ggcaataccgccgctatctgtatctatcctcgctttatcccgattgctcgcaaaactctg
aaagagcagggcaccccggaaatccgtatcgctacggtaaccaacttcccacacggtaac
gacgacatcgacatcgcgctggcagaaacccgtgcggcaatcgcctacggtgctgatgaa
gttgacgttgtgttcccgtaccgcgcgctgatggcgggtaacgagcaggttggttttgac
ctggtgaaagcctgtaaagaggcttgcgcggcagcgaatgtactgctgaaagtgatcatc
gaaaccggcgaactgaaagacgaagcgctgatccgtaaagcgtctgaaatctccatcaaa
gcgggtgcggacttcatcaaaacctctaccggtaaagtggctgtgaacgcgacgccggaa
agcgcgcgcatcatgatggaagtgatccgtgatatgggcgtagaaaaaaccgttggtttc
aaaccggcgggcggcgtgcgtactgcggaagatgcgcagaaatatctcgccattgcagat
gaactgttcggtgctgactgggcagatgcgcgtcactaccgctttggcgcttccagcctg
ctggcaagcctgctgaaagcgctgggtcacggcgacggtaagagcgccagcagctactaa
              
                            

Download fasta file
RegulonDB