RegulonDB RegulonDB 10.9: Gene Sequence
dgt gene sequence


Size: 1518        A: 395  T: 395  G: 384  C: 344

Fasta

 

>dgt E. coli K12. Version NC_000913.3 GI:556503834
atggcacagattgatttccgaaaaaaaataaactggcatcgtcgttaccgttcaccgcag
ggcgttaaaaccgaacatgagatcctgcggatcttcgagagcgatcgcgggcgtatcatc
aactctccggcaattcgtcgtctgcaacaaaagacccaggtttttccactggagcgcaat
gccgccgtgcgcacgcgtcttacccactcgatggaagtccagcaggtggggcgctacatc
gccaaagaaattttaagccgtctgaaagagcttaaattactggaagcatacggcctggat
gaactgaccggtccctttgaaagcattgttgagatgtcatgcctgatgcacgatatcggc
aatccgccgtttggtcattttggcgaagcggcgataaatgactggtttcgccaacgtttg
cacccggaagatgccgaaagccagcctctgactgacgatcgctgcagcgtggcggcacta
cgtttacgggacggggaagaaccgcttaacgagctgcggcgcaagattcgtcaggactta
tgtcattttgaggggaatgcacaaggcattcgcctggtgcatacattgatgcggatgaat
ctcacctgggcacaggttggcggtattttaaaatatacccgtccggcgtggtggcgtggc
gaaacgcctgagacacatcactatttaatgaaaaagccgggttattatctttctgaagaa
gcctatattgcccggttgcgtaaagaacttaatttggcgctttacagtcgttttccatta
acgtggattatggaagctgccgacgacatctcctattgtgtggcagaccttgaagatgcg
gtagagaaaagaatatttaccgttgagcagctttatcatcatttgcacgaagcgtggggc
cagcatgagaaaggttcgctcttttcgctggtggttgaaaatgcctgggaaaaatcacgc
tcaaatagtttaagccgcagtacggaagatcagttttttatgtatttacgggtaaacacc
ctaaataaactggtaccctacgcggcacaacgatttattgataatctgcctgcgattttc
gccggaacgtttaatcatgcattattggaagatgccagcgaatgcagcgatcttcttaag
ctatataaaaatgtcgctgtaaaacatgtgtttagccatccagatgtcgagcggcttgaa
ttgcagggctatcgggtcattagcggattattagagatttatcgtcctttattaagcctg
tcgttatcagactttactgaactggtagaaaaagaacgggtgaaacgtttccctattgaa
tcgcgcttattccacaaactctcgacgcgccatcggctggcctatgtcgaggctgtcagt
aaattaccgtcagattctcctgagtttccgctatgggaatattattaccgttgccgcctg
ctgcaggattatatcagcggtatgaccgacctctatgcgtgggatgaataccgacgtctg
atggccgtagaacaataa
              
                            

Download fasta file
RegulonDB