RegulonDB RegulonDB 10.9: Gene Sequence
dicA gene sequence


Size: 408        A: 143  T: 87  G: 80  C: 98

Fasta

 

>dicA E. coli K12. Version NC_000913.3 GI:556503834
atggaaacaaaaaatttaactatcggcgaacgcatcaggtatcgtcggaaaaacctcaaa
cacacccaaaggtctcttgctaaagccctgaaaatctcccatgtgtctgtatcacaatgg
gaacggggtgatagtgaacctacagggaagaacctttttgccctcagtaaagtattgcaa
tgctcaccaacatggattctatttggcgatgaagacaagcaaccaacaccacctgttgag
aagccagttgccttatcccccaaagaactagagctccttgagctgtttaatgcactgcca
gaatcagaacaggatacccagctcgccgaaatgcgagctcgagtaaaaaacttcaataaa
ctctttgaagaattactaaaagcccgtcagcggacaaataaaagataa
              
                            

Download fasta file
RegulonDB