RegulonDB RegulonDB 10.9: Gene Sequence
dicB gene sequence


Size: 189        A: 67  T: 54  G: 38  C: 30

Fasta

 

>dicB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacgttattaccaaacgttaatacgtctgaaggttgttttgaaattggtgtcact
atcagtaacccagtatttactgaagatgccattaacaagagaaaacaagaacgggagcta
ttaaataaaatatgcattgtttcaatgctggctcgtttacgtctgatgccaaaaggatgt
gcacaatga
              
                            

Download fasta file
RegulonDB