RegulonDB RegulonDB 10.9: Gene Sequence
dicC gene sequence


Size: 231        A: 63  T: 60  G: 63  C: 45

Fasta

 

>dicC E. coli K12. Version NC_000913.3 GI:556503834
atgcttaaaactgacgctcttttgtatttcggttcaaaaacaaaacttgcacaagcagca
ggtattcgtttggcttcgctttatagctggaaaggggatttagttcccgaaggtcgcgcg
atgcgtctacaggaggcatctggcggggagcttcagtatgatcccaaagtttatgatgaa
tatcgtaagacgaagcgggcggggcggttgaacaatgaaaatcactcctga
              
                            

Download fasta file
RegulonDB