RegulonDB RegulonDB 10.9: Gene Sequence
dnaC gene sequence


Size: 738        A: 212  T: 153  G: 194  C: 179

Fasta

 

>dnaC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaacgttggcgacctgatgcaacgcctgcaaaaaatgatgcctgcccatatcaaa
cccgcattcaaaacgggtgaagaactactggcctggcaaaaagaacaaggagcgatccgc
tccgccgctctcgaacgtgaaaatcgggcgatgaaaatgcagcgcacctttaaccgctcc
ggtattcgtccactgcatcagaactgttcctttgagaactatcgcgttgagtgtgaaggg
cagatgaatgcgttaagcaaagcgcgccagtatgtcgaagagtttgacggcaacatcgcc
agcttcatcttttctggtaagccaggaaccggcaaaaaccatctggcggcggcaatctgc
aacgagctgctgctacgcggtaaatccgtattgatcatcaccgtggccgatattatgtcg
gcgatgaaagataccttcaggaatagcggtaccagcgaagaacaactgcttaacgatctg
agcaacgttgatctgctggtgatcgatgagatcggcgtgcagaccgaatcgaaatacgaa
aaagtgatcatcaaccagatcgtcgatcgccgctcttcttccaaacgcccaaccgggatg
ctgaccaacagtaatatggaagagatgaccaagttgctgggcgaacgcgtgatggaccgt
atgcgcctgggtaacagtttgtgggtgatcttcaactgggatagctaccgtagccgggta
acaggtaaagagtattaa
              
                            

Download fasta file
RegulonDB