RegulonDB RegulonDB 10.9: Gene Sequence
dnaE gene sequence


Size: 3483        A: 812  T: 757  G: 1029  C: 885

Fasta

 

>dnaE E. coli K12. Version NC_000913.3 GI:556503834
atgtctgaaccacgtttcgtacacctgcgggtgcacagcgactactcgatgatcgatggc
ctggccaaaaccgcaccgttggtaaaaaaggcggcggcgttgggtatgccagcactggcg
atcaccgatttcaccaacctttgtggtctggtgaagttctacggagcgggacatggcgca
gggattaagcctatcgtcggggcagattttaacgtccagtgcgacctgctgggtgatgag
ttaacccacctgacggtactggcggcgaacaataccggctatcagaatctgacgttgctg
atctcaaaagcgtatcagcgcgggtacggtgccgccgggccgatcatcgatcgcgactgg
cttatcgaattaaacgaagggttgatccttctttccggcggacgcatgggcgacgtcgga
cgcagtcttttgcgtggtaacagcgcgctggtagatgagtgtgtcgcgttttatgaagaa
cacttcccggatcgctattttctcgagctgatccgcaccggcaggccggatgaagaaagc
tatctgcacgcggcggtggaactggcggaagcgcgcggtttgcccgtcgtggcgaccaac
gacgtgcgctttatcgacagcagcgactttgacgcacacgaaatccgcgtcgcgatccac
gacggctttaccctcgacgatcctaaacgcccgcgtaactattcgccgcagcaatatatg
cgtagcgaagaggagatgtgtgagctgtttgccgacatccccgaagcccttgccaacacc
gttgagatcgccaaacgctgtaacgtaaccgtgcgtcttggtgaatacttcctgccgcag
ttcccgaccggggacatgagcaccgaagattatctggtcaagcgtgcaaaagagggcctg
gaagagcgtctggcctttttattccctgatgaggaagaacgtcttaagcgccgcccggaa
tatgacgaacgtctggagactgaacttcaggttatcaaccagatgggcttcccgggctac
ttcctcatcgttatggaatttatccagtggtcgaaagataacggcgtaccggtagggcca
ggccgtggctccggtgcgggttcactggtggcctacgcgctgaaaatcaccgacctcgat
ccgctggaatttgacctgctgttcgaacgtttccttaacccggaacgtgtctccatgcct
gacttcgacgttgacttctgtatggagaaacgcgatcaggttatcgagcacgtagcggac
atgtacggtcgtgatgcggtatcgcagatcatcaccttcggtacaatggcggcgaaagcg
gtgatccgcgacgtaggccgcgtgctggggcatccgtacggctttgtcgatcgtatctcg
aaactgatcccgcccgatccggggatgacgctggcgaaagcgtttgaagccgagccgcag
ctgccggaaatctacgaagcggatgaagaagttaaggcgctgatcgacatggcgcgcaaa
ctggaaggggtcacccgtaacgccggtaagcacgccggtggggtggttatcgcgccgacc
aaaattaccgattttgcgccgctttactgcgatgaagagggcaaacatccggtcacccag
tttgataaaagcgacgttgaatacgccggactggtgaagttcgacttccttggtttgcgt
acgctcaccatcatcaactgggcgctggagatgatcaacaagcggcgggcgaagaatggc
gagccgccgctggatatcgctgcgatcccgctggatgataagaaaagcttcgacatgctg
caacgctcggaaaccacggcggtattccagcttgaatcgcgcggcatgaaggacctgatc
aagcgtctacaacctgactgcttcgaagatatgatcgccctagtggcactgttccgcccc
ggtccgttgcaatcagggatggtggataactttatcgaccgtaaacatggtcgtgaagag
atctcctatccggacgtacagtggcagcatgaaagcctgaaaccggtactggagccaacc
tacggcattatcctgtatcaggaacaggtcatgcagattgcgcaggtgctttctggttat
accctcggtggcgcggatatgctgcgtcgtgcgatgggtaagaaaaagccggaagagatg
gctaagcaacgttctgtatttgctgaaggtgcagaaaagaacggaatcaacgctgaactg
gcgatgaaaatcttcgacctggtggagaaattcgctggttacggatttaacaaatcgcac
tctgcggcctatgctttggtgtcatatcaaacgttatggctgaaagcgcactatcctgcg
gagtttatggcggcggtaatgaccgccgatatggacaacaccgagaaggtggtgggtctg
gtggatgagtgctggcggatggggctgaaaatcctgccaccagatataaactccggtctt
taccatttccacgtcaacgacgacggcgaaatcgtgtatggtattggcgcgatcaaaggg
gtcggtgaaggtccgattgaggccatcatcgaagcccgtaataaaggcggctacttccgc
gaactgtttgatctctgcgcccgtaccgacaccaaaaagttgaaccgtcgcgtgctggaa
aaactgatcatgtccggggcgtttgaccgtcttgggccacatcgcgcagcgctgatgaac
tcgctgggcgatgcgttaaaagcggcagatcaacacgcgaaagcggaagctatcggtcag
gccgatatgttcggcgtgctggccgaagagccggaacaaattgaacaatcctacgccagc
tgccaaccgtggccggagcaggtggtattagatggggaacgtgaaacgttaggcctgtac
ctgaccggacaccctatcaaccagtatttaaaagagattgagcgttatgtcggaggcgta
aggctgaaagacatgcacccgacagaacgtggtaaagtcatcacggctgcggggctcgtt
gttgccgcgcgggttatggtcaccaagcgcggcaatcgtatcggtatctgcacgctggat
gaccgttccgggcggctggaagtgatgttgtttactgacgccctggataaataccagcaa
ttgctggaaaaagaccgcatacttatcgtcagcggacaggtcagctttgatgacttcagc
ggtgggcttaaaatgaccgctcgcgaagtgatggatattgacgaagcccgggaaaaatat
gctcgcgggcttgctatctcgctgacggacaggcaaattgatgaccagcttttaaaccga
ctccgtcagtctctggaaccccaccgctctgggacaattccagtacatctctactatcag
agggcggatgcacgcgcgcggttgcgttttggcgcgacgtggcgtgtctctccgagcgat
cgtttattaaacgatctccgtggcctcattggttcggagcaggtggaactggagtttgac
taa
              
                            

Download fasta file
RegulonDB