RegulonDB RegulonDB 10.9: Gene Sequence
dnaJ gene sequence


Size: 1131        A: 276  T: 231  G: 346  C: 278

Fasta

 

>dnaJ E. coli K12. Version NC_000913.3 GI:556503834
atggctaagcaagattattacgagattttaggcgtttccaaaacagcggaagagcgtgaa
atcagaaaggcctacaaacgcctggccatgaaataccacccggaccgtaaccagggtgac
aaagaggccgaggcgaaatttaaagagatcaaggaagcttatgaagttctgaccgactcg
caaaaacgtgcggcatacgatcagtatggtcatgctgcgtttgagcaaggtggcatgggc
ggcggcggttttggcggcggcgcagacttcagcgatatttttggtgacgttttcggcgat
atttttggcggcggacgtggtcgtcaacgtgcggcgcgcggtgctgatttacgctataac
atggagctcaccctcgaagaagctgtacgtggcgtgaccaaagagatccgcattccgact
ctggaagagtgtgacgtttgccacggtagcggtgcaaaaccaggtacacagccgcagact
tgtccgacctgtcatggttctggtcaggtgcagatgcgccagggattcttcgctgtacag
cagacctgtccacactgtcagggccgcggtacgctgatcaaagatccgtgcaacaaatgt
catggtcatggtcgtgttgagcgcagcaaaacgctgtccgttaaaatcccggcaggggtg
gacactggagaccgcatccgtcttgcgggcgaaggtgaagcgggcgagcatggcgcaccg
gcaggcgatctgtacgttcaggttcaggttaaacagcacccgattttcgagcgtgaaggc
aacaacctgtattgcgaagtcccgatcaacttcgctatggcggcgctgggtggcgaaatc
gaagtaccgacccttgatggtcgcgtcaaactgaaagtgcctggcgaaacccagaccggt
aagctattccgtatgcgcggtaaaggcgtcaagtctgtccgcggtggcgcacagggtgat
ttgctgtgccgcgttgtcgtcgaaacaccggtaggcctgaacgaaaggcagaaacagctg
ctgcaagagctgcaagaaagcttcggtggcccaaccggcgagcacaacagcccgcgctca
aagagcttctttgatggtgtgaagaagttttttgacgacctgacccgctaa
              
                            

Download fasta file
RegulonDB