RegulonDB RegulonDB 10.9: Gene Sequence
dnaK gene sequence


Size: 1917        A: 543  T: 394  G: 505  C: 475

Fasta

 

>dnaK E. coli K12. Version NC_000913.3 GI:556503834
atgggtaaaataattggtatcgacctgggtactaccaactcttgtgtagcgattatggat
ggcaccactcctcgcgtgctggagaacgccgaaggcgatcgcaccacgccttctatcatt
gcctatacccaggatggtgaaactctagttggtcagccggctaaacgtcaggcagtgacg
aacccgcaaaacactctgtttgcgattaaacgcctgattggtcgccgcttccaggacgaa
gaagtacagcgtgatgtttccatcatgccgttcaaaattattgctgctgataacggcgac
gcatgggtcgaagttaaaggccagaaaatggcaccgccgcagatttctgctgaagtgctg
aaaaaaatgaagaaaaccgctgaagattacctgggtgaaccggtaactgaagctgttatc
accgtaccggcatactttaacgatgctcagcgtcaggcaaccaaagacgcaggccgtatc
gctggtctggaagtaaaacgtatcatcaacgaaccgaccgcagctgcgctggcttacggt
ctggacaaaggcactggcaaccgtactatcgcggtttatgacctgggtggtggtactttc
gatatttctattatcgaaatcgacgaagttgacggcgaaaaaaccttcgaagttctggca
accaacggtgatacccacctggggggtgaagacttcgacagccgtctgatcaactatctg
gttgaagaattcaagaaagatcagggcattgacctgcgcaacgatccgctggcaatgcag
cgcctgaaagaagcggcagaaaaagcgaaaatcgaactgtcttccgctcagcagaccgac
gttaacctgccatacatcactgcagacgcgaccggtccgaaacacatgaacatcaaagtg
actcgtgcgaaactggaaagcctggttgaagatctggtaaaccgttccattgagccgctg
aaagttgcactgcaggacgctggcctgtccgtatctgatatcgacgacgttatcctcgtt
ggtggtcagactcgtatgccaatggttcagaagaaagttgctgagttctttggtaaagag
ccgcgtaaagacgttaacccggacgaagctgtagcaatcggtgctgctgttcagggtggt
gttctgactggtgacgtaaaagacgtactgctgctggacgttaccccgctgtctctgggt
atcgaaaccatgggcggtgtgatgacgacgctgatcgcgaaaaacaccactatcccgacc
aagcacagccaggtgttctctaccgctgaagacaaccagtctgcggtaaccatccatgtg
ctgcagggtgaacgtaaacgtgcggctgataacaaatctctgggtcagttcaacctagat
ggtatcaacccggcaccgcgcggcatgccgcagatcgaagttaccttcgatatcgatgct
gacggtatcctgcacgtttccgcgaaagataaaaacagcggtaaagagcagaagatcacc
atcaaggcttcttctggtctgaacgaagatgaaatccagaaaatggtacgcgacgcagaa
gctaacgccgaagctgaccgtaagtttgaagagctggtacagactcgcaaccagggcgac
catctgctgcacagcacccgtaagcaggttgaagaagcaggcgacaaactgccggctgac
gacaaaactgctatcgagtctgcgctgactgcactggaaactgctctgaaaggtgaagac
aaagccgctatcgaagcgaaaatgcaggaactggcacaggtttcccagaaactgatggaa
atcgcccagcagcaacatgcccagcagcagactgccggtgctgatgcttctgcaaacaac
gcgaaagatgacgatgttgtcgacgctgaatttgaagaagtcaaagacaaaaaataa
              
                            

Download fasta file
RegulonDB