RegulonDB RegulonDB 10.9: Gene Sequence
mltD gene sequence


Size: 1359        A: 371  T: 282  G: 378  C: 328

Fasta

 

>mltD E. coli K12. Version NC_000913.3 GI:556503834
atgaaggcaaaagcgatattactcgcctctgtcctgctcgtgggttgccagagtaccggc
aacgttcaacagcacgcacagagcctttctgcagctggtcaaggggaagcagcaaagttt
acaagtcaggcacgatggatggacgatgggacgtctatcgcgccagatggtgacttgtgg
gctttcattggcgacgagctaaagatgggaattccggaaaatgaccggattcgcgaacag
aaacagaaatatttacgcaataagagctatctccacgatgtaactttacgggcagagccg
tatatgtactggatagcagggcaagttaaaaaacgtaacatgcctatggaactggtacta
ctacccatagtggagagcgcttttgatcctcacgcaacgtctggcgccaatgccgcaggc
atctggcagatcattccgagcacggggcgcaattatggtttgaaacagacccgcaattat
gacgcgcgtcgcgatgttgttgcttcaacaactgccgcgctgaatatgatgcagcgtctg
aacaaaatgtttgacggcgactggcttctgaccgtagcggcttataacagcggcgaaggt
cgggtcatgaaggcaattaaaacgaacaaagcgcgtgggaaatccacggacttctggtcg
ttaccgttgccgcaggaaacgaagcagtacgtgcctaaaatgctggcattgagtgatatt
ctcaaaaacagcaagcgttatggcgtacgtctgccaacgaccgatgaaagccgtgctctg
gcgcgtgtgcacctgagcagcccggttgaaatggcgaaggtagcagatatggcggggatt
tccgtcagcaagctgaagacattcaacgctggcgtaaaaggctccacgctgggcgcaagt
ggcccgcagtacgtgatggtgccaaagaagcatgcagatcaactgcgtgaatctctggct
tcaggcgaaattgctgctgtacagtcgacgctggttgccgacaatacgccgcttaacagc
cgtgtttacaccgtacgctctggcgacacgctttcaagtatcgcttcacgtctcggcgta
agcaccaaagatttgcagcagtggaacaaactgcgcggatctaagctgaagccaggccaa
agtttgacgattggtgcaggcagtagcgcacagcgactggcaaacaacagcgatagcatt
acgtatcgtgtgcgcaaaggcgattcgctttcaagcattgctaaacgccacggcgtgaac
atcaaagatgtgatgcgctggaacagcgacactgcgaatctgcaaccaggcgataagctg
acgttgtttgtgaaaaacaacaacatgccagattcctga
              
                            

Download fasta file
RegulonDB