RegulonDB RegulonDB 10.9: Gene Sequence
acpS gene sequence


Size: 381        A: 98  T: 87  G: 114  C: 82

Fasta

 

>acpS E. coli K12. Version NC_000913.3 GI:556503834
atggcaatattaggtttaggcacggatattgtggagatcgctcgcatcgaagcggtgatc
gcccgatccggtgatcgcctggcacgccgcgtattaagcgataacgaatgggctatctgg
aaaacgcaccaccagccggtgcgttttctggcgaagcgttttgctgtgaaagaagccgca
gcaaaagcgtttggcaccgggatccgcaatggtctggcgtttaatcaatttgaagtattc
aatgatgagctcggcaaaccacggctacggctatggggcgaggcattaaaactggcggaa
aagctgggcgttgcaaatatgcatgtaacgctggcagatgagcggcactatgcttgtgcc
acggtaattattgaaagttaa
              
                            

Download fasta file
RegulonDB